Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_F53F10.2_b   

mv_F53F10.2_bSequenceAAAAGAATTCGTTCAAATCCTCGATCA
Length27
PCR_productmv_F53F10.2