Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_T02E1.3b_b   

mv_T02E1.3b_bSequenceAAATCGAGTGACTCTGATGACAGG
Length24
PCR_productmv_T02E1.3b