Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_W05H7.4_b   

mv_W05H7.4_bSequenceAAGCTTGGCTCATCTCATCGT
Length21
PCR_productmv_W05H7.4