Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_ZK546.6_b   

mv_ZK546.6_bSequenceATGGGTTGTACTCAATTGGGAGGTT
Length25
PCR_productmv_ZK546.6