Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_AH10.2   

sjj_AH10.2RNAiJA:AH10.2
PCR_productsjj_AH10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSAH10.2 Source_evidenceePCR706WS150 Sequence/Annotation Release
Overlaps_Gene AH10.2 Source_evidenceePCR706WS150 Sequence/Annotation Release
Chunk_score Abs_score663
Max_abs_score663AH10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1415937514160179
Overlaps_transcriptAH10.2 Source_evidenceePCR706WS150 Sequence/Annotation Release
WB_DNA_textsjj_AH10.2805caacacagaattccagtcattcaatctgatttttctcgcatcagaatgttctctttttctagagctgttattatattctttactattttcccattgatctctgcaactggacatcttcggttggaactaacgtcgtccaaaaactttatcttacaactgaagacgaacacaagtttccaagaaatccagcttgctatgggtaatccaagaacactgagcttccacccaaaagaccatcaagaaacgcttgagatctcattttccaataatgttagcgatctgacaacagtggaatatcatatgaatagtaatgaactcaatacttatcaaactattctattctctgacgccgttttattggttcagtcagttttcaagtgtgataccgggttcgttggagataaatgccaagatattattacttctacctctaccacagtgatttccacaactacaacagaaatcaaaacttcaactactaaggtaattatagtaatcaatgatgttccaaaagaagcttcggccctgcaacagtaagtttaatttctcaaagttaataatttctgattaatcaaaaacattttcagatccatctctttaaacgtcattcattgctccgtgctcatcgtgatcatcatagtacttctcattcttatcattatcgtctacatcttcctccgtccacatcatcaaaaacacgtttacattcaaccggaatctccagcccaaaatgagagaaaatgctctgttctccttgaagaatcaggttatttttcgccactagaaagcccaagatatacggaag