Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0207.10   

sjj_B0207.10RNAiJA:B0207.10
PCR_productsjj_B0207.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0207.10 Source_evidenceePCR297WS150 Sequence/Annotation Release
Overlaps_Gene B0207.10 Source_evidenceePCR297WS150 Sequence/Annotation Release
Chunk_score Abs_score234
Max_abs_score234B0207.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI59589925959961
Overlaps_transcriptB0207.10 Source_evidenceePCR297WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0207.10970gacgtcacgcagttacaacataacaaagtaaaatttttattggcgagaacgttcaataatttgtacaagaagtacaattccacaaacagtgacgagaagagttgcagtcattacgatgcaaacaaaatgtgaactgttcatcaactttgcacggcgaatcgtgtttcgattgttgaatgagtcttcgtcactgtcatttgacaaatttagacgtagttctgaaagattgtccgtcaaataccgtcaaataccaaaattttttttgtccgtcaaataccaaaattttatcattgagtaaagcagcttacctacacttatattatcaaaaaaattcaacagatacgatcaagaaatcataaagaaatatttcttgataaaattaaacgatgtataaatatataaaagtcgacgtggagcaaggcaatcaatgctaacgggaaaatacagtaatataatctaatacaaaccttctttattgtgcttcagtgtgccgacatttccaataaactgattttcctccgagctgctcattgacttctgaaaattattttttgaaaatttaaaatgagaggaatgataaaatctcacttaaaattaaattgaaataaagtgaaacgaaggaatattgaaaggatttatgagagattagatgggatacttctgttgccattctgaaaaatgtattttgagcttgttgagccatctttcagaagaaatccaaatcaattgaatttatttataatttttagaaagttgataaaatctcatttttttgtcaaaaaaaaattgaaatgtttcttagattttttgctatgatacttgctcattgtggtaccatatgcttgtttcaaatcaattcaacgcttttctacctttaattaagtaacgcttctgtaaaatccccagctaggtatgccttttattctacgtttgttggattaaaaaaatgtcaaatctcaaaatcgtgttg