Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0222.7   

sjj_B0222.7RNAiJA:B0222.7
PCR_productsjj_B0222.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0222.7 Source_evidenceePCR885WS150 Sequence/Annotation Release
Overlaps_Gene (13)
Overlaps_transcriptB0222.7 Source_evidenceePCR901WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0222.71595aggatcagattgttggtcggctgactctaatttgaacgcttctttttcgaagcgaaaaatcagactttatgaagattgattaatgatgtagcaatgattttgtatctcaaaaatgtttttgttgttgtttttggttatattggacaacagaagaaaaggttgaatcaaacaataaatgttgagtaactacatgattttacactacattgcttcaatcgggtgctactgttgacttctccttatgttttcagctgatttcaatcggtaaacaaggctgttaaaaatatgaaagacaaagtaaaaattttattttatgacatggaaagtattgagaatacaatgaaagtaaatttaatggcgggaaaggaaaacagcggatcttggtgggcaagcgcaataagcggcgtcgtttcctggaagtcctggtcctcctggggctcctggctgtccatcggatccagcatttcctgggaatccgtcttgcccagctggtccggctggtcctggggctccgtcttgtcctgggaatccatcttgtcctgctggtccagctggtccagcgtttcctggggctcctggggctcctggagctccagatccgcgttgtccgtcggctcctggctgtcctgggaatccgtcttgtcctggtgttcctggttgtccgttgtctcctggggctcctggggctcctgggaatccgtcgttaccgcgttgtcctgggaatcctggttgtccgtctggtccggctggtccggctggtcctgatggtccggctggtcctgctggtccttgtgggcacttgacgcaatcttgggagacttgggcgcaggtcagtggagcgaaggtagcggtgttgtcgtctccctttggtcctggggctcctggggttcctggggctcctggctgtcctggtggtcctggtggtcctggtgggcaagttggcttagttggctcacattggcaccaggctggaagtccagagaaagtttgacgcttttgacggaagacggagttgaatgggttgacacgtggcttggttggtggggtaacggtgatctggatgtccatcatctcggtccatgcagagtcggtctcaacacggaaaacagagactccatcgagtacctataaaattgaaattttgttttaactattttgtaaaagtatatatatataaacctgatcgtgaacttcattgatggtgttgtagagggatgggacggtgaaaagaacagcaagaacagcaatggaggcagctccggtagaaaaggttacaagaatcttctccatgactgaaagccttggtgtctttcctagttatcttgcctccttttatactcctctttttgaattactcatacagtttttttttgcatagagatgtgtaatgaaatattccatttgtctccatgaactcgctttttttcttgtctttcttgcctcaacttcctcattcagaagccacaaacgaggaagatagtaaagtgggcaggccgtagagaaaaagcggacaaagatgaaatgcttttctctcagtaggtgatagaggaagaaggacggacaactttctctcgaggcgattgcatgatatgttg