Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0250.1   

sjj_B0250.1 RNAi JA:B0250.1
Simmer:B0250.1
PCR_productsjj_B0250.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0250.1 (3)
B0250.9 Source_evidenceePCR66WS150 Sequence/Annotation Release
B0250.3 Chunk_score (3)
Overlaps_transcript B0250.1.1 Source_evidenceePCR843WS150 Sequence/Annotation Release
B0250.1.2 Source_evidenceePCR789WS150 Sequence/Annotation Release
B0250.9 Source_evidenceePCR66WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0250.11605aatttccctcttctccttgtgtcgatttacgagaaatgttaaaggcgcacgctatttatcgggctgtcgtggcgagacccaccctctccgccgcagctgcttggctctcgttttcttctattttttcggctggcctaaacttttttcgccaattttgaagattttcagtaatttttttttgtttttatgttcaaataattatagaaattcaattttaatgcttgttttgatcattcgtcgtctctttctctctcaaaatctcgattttttcggctttttatctgaaaaatattattttccgtctaaatacgaatttttaattctcagttccgatagtttgtcatctctttcgctgttttacttttattttcgtctatttttgtagtgtttacctcttttccgcagatttcagtcataattattgaattttttcagggtaacatgggacgtcgtatccgcatccagcgtaaaggagctggtggaatcttcaagagccacaacaagcaccgcaaaggagcgtccaagctccgtcctcttgactatgccgagagacatggctacatcaagggactcgtgaaggacatcatccacgacccaggaagaggagctccacttgccatcatcgctttccgcgacccatacaagtacaagaccgtgaagactaccgtcgtcgccgccgaaggaatgcacactggacaattcatccattgtggagctaagggttagtttttccttcagtttgaagcatccggcttgtcctttttaatctggcctgaattattttgattctacgcccttcaggaaggaccataggaaattttgcctcttacccccggtgtgatagtttgtcagaatcggtcattgtgtgcacgaacactttactttcgaaattttagaactaaacatttcatttttagttactaaattctaattattatttttttcagctcaaatccaaatcggaaacatcgtgccagtcggaaccctcccagaaggaaccaccatctgcaacgtcgagaacaagtccggagaccgtggagtcatcgcccgtgcctctggtaagttttgcacaaataccaatataatcttcattaatcaattaattaattttcaggtaactacgccaccgtcatcgcccacaacccagacaccaagaagacacgtattcgcctcccatccggagccaagaaggtcgttcaatcggtcaaccgcgccatgattggactcgtcgctggaggaggacgtaccgacaagccacttctcaaggctggacgctcataccacaagtacaaggcaaagagaaacagctggccacgtgtcagaggagttgccatgaatccagtcgaacatccccacggaggaggtaaccatcaacatattggacatccatccaccgtcagaagagacgccagtgccggaaagaaggttggacttatcgccgcccgccgtaccggaagaattcgcggaggaaagccagtcaagttcaccaaggaggagaacgtctaaatgtattgttatttgttattcaacaaaatacatttttgttattaaaaaaccgcttgtctttctttcatcaaaaaattgagagctcgataattttggaac