Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0348.4   

sjj_B0348.4 RNAi (11)
PCR_productsjj_B0348.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS B0348.4a Source_evidenceePCR737WS150 Sequence/Annotation Release
B0348.4b Source_evidenceePCR737WS150 Sequence/Annotation Release
B0348.4c Source_evidenceePCR737WS150 Sequence/Annotation Release
Overlaps_Gene B0348.4 Source_evidenceePCR737WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV2461226121
Overlaps_transcript B0348.4b Source_evidenceePCR737WS150 Sequence/Annotation Release
B0348.4a Source_evidenceePCR737WS150 Sequence/Annotation Release
B0348.4c Source_evidenceePCR737WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0348.41510gcagatccggacagaaagagtacctaaccaaagagcgactcatcaattttctgaatgaagaacaacgtgatccacgactcaacgagatcctcttcccattttttgattctcagcgtatcgttgcgcttctcaaaaaacacgaaaacgacataaaatatcaagaagatggaaaaatgtccggtgacgggtttctccgattcctgatgtcagacgagaacccgccagtgtttctagaccgaattgaaatgtttatggatatggatcaaccgctgtgtcactactacatcaatagttcccataacacgtatcttaccggacggcagtatggtggaaaatcgtcttctgagatttatcgacaagttttgctcagcggatgtaggtgtattgagcttgattgttgggatggtactggtgaaaataaaggagaacccattatcactcacggaaaggccatgtgcacagacgtgttcttcaaggtgggtattttgaacttttgaaaaataaaaaagcaaaaagaaacaaacaaacaagcaaataaacaaacagacatgcaggcaggcagggaggaagggaggtagataggcaggtaagcagttgggcaggaaggcagataggcaggcaggcgacagaagacaaacaaaatttcgaccaaaatacaaaaaaacaaaaacttttttttgctaatttggatcctaaaacaaaacacaaaaattgattttctccaaaatccaaaacaaaaccaaaaaaaaaccactaaaaaacaaaaaaatgttcgatttttcttaacaggccaacatgatccgaaaaaaaccaaaaacaaaaaaaaacaaaaagcggcagccctgttaagcagataggcaggtaggcaggtaggcaggtaggcacgtggtgtcaggctgttccattacggtttgatctacaaatatgggggaattttttccttaaaaaatgtgatgtcagcacgtttttatccatacgaaatcagttgagagctctgcgtctaaattctcgcgattctcgtagatcaaaccgaaatgggacattctgacaccacgtgggtaggtagattgacaggtacgcaggcagccatacaggcaaaaaacaatcaatcaaacatacaaactaactaactaactaaagttgatcccttaattctggaaacatattttttaacttttcaggacgtcctggtacaaattcgagacaccgcatttgcccggtcggattttccagtggtcctttccttcgaaaaccattgctcaaaatcaaatcagctgaaaatggccaaatattgtatggacatttttggagatatgctgctgtccaaaccgtttgaagatgcgcctgtaagtctgcagccgacgaaatctaggctcaaattttcactccaactagagaaaacatttccagcttgaccccggagtctccctaccttctccaaaccgcctgcgaaagaagatccttatcaaaaataagcgattaaaaaccgacatcgaacgtcaccaacttg