Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0365.6   

sjj_B0365.6 RNAi JA:B0365.6
Simmer:B0365.6:Repeat_a
Simmer:B0365.6:Screen
PCR_productsjj_B0365.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0365.6 Source_evidenceePCR847WS150 Sequence/Annotation Release
Chunk_score Abs_score764
Max_abs_score764B0365.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1313899013140148
Overlaps_transcript B0365.6.3 Source_evidenceePCR847WS150 Sequence/Annotation Release
B0365.6.1 Source_evidenceePCR847WS150 Sequence/Annotation Release
B0365.6.2 Source_evidenceePCR847WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0365.61159catgggcggaacactactttcattgtatttgttgttgaagtgtaccattgattgcttgcagaatttccttgaagaacaaccaaaggtgtagtgtcttcaattcgactgtaaatggaaattgatgcctgactatccagattcattactgggaatcgaatttggacaagtgagccgacgggagtgtcaagaatgtagttgcatggattctgctcgccaatgtagctgtacggccagcttggggaatagaactgaaaaaaaattaaatttggaaataattgcaatatttgacaaaatagcagacataatcatttttggagttcaaggtagtatcattggtaaaattgattatatgaatataaaaattgaattaatgtttgatgtcttttagaaaataaaattcaaaatcttaaaacctactcttccagagttatccataaacattggagaagtgcactgtcctggtgtttgagttggtccagaagttgttccacactgtgttccaacttttctcttacaaacaaatggtagagaagtatcacaatagctactaatccattttccagttgaaacaatatcatttgaaagagccatactccaacacattccaagatttatatttgagtatccaatgttgtcataattccagcttgttccatcaatccaactattagaattttgattattagctactgctccaattcgaatatatgttggtgcatttgttgtgaataaagattgaacataattattttcttcaatcgagtgaattgatacaagatttccacatgcttgttggcaagaaaattgagcatcttgtttgggaagggcagaaagagacggataatagcaatttccattatattggaatgaacaggtatcggtgattgggcttgttggtgctgtttcacagataaagttcaggctcattgtgttacagtctccgctgagccattttcccgcaaatgagccacttgttggcacgtagacgcagtttccaacttcaacaagagggtatcctgaaaataaatattgatcttaagaaacatttaagattctaagaattctaacaaaatcgcaacttcccttttaaaaatttcacacgatccttcaacttggtagaaaaataaatgaataaaagatagctcgaaagctggtggtt