Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0414.5   

sjj_B0414.5 RNAi JA:B0414.5
PF:GL1_6C5
PCR_productsjj_B0414.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0414.5 Source_evidenceePCR985WS150 Sequence/Annotation Release
Overlaps_Gene B0414.5 Source_evidenceePCR1014WS150 Sequence/Annotation Release
Chunk_score Abs_score972
Max_abs_score972B0414.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI57906955791758
Overlaps_transcriptB0414.5 Source_evidenceePCR1014WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0414.51064cttgtccaggccattcaactgcacacgaaccaaattctccaaatgaatcttttaaagctgcctcagtgatatcccatggaactcctccaacaaatatcttccgtgagaatgttggacttgtataatctctgggcggaagctctccaaaccaagttgcgtcgctatcacggtttttatttccatgttcttgttggaagttttttcttttcatcggagattcctcatttgcagatgtgaagtgctctcgagatggaaactgattcatactgtcagaaggagacgattcggttgaactgctgaagcctttttgcggagaatctgtaggagtctcaagggaaccacgaggattacggtagagattccgatttgccttattgattggaacgggagcacccttcgagataactatcttctcatattctctagtcatttcagcaacgaatgaactattatttgtttttgttgaatccttcttttgctctgcgtctctctcgaaatttagtcgccgagcagatttcttacgctgtgaatttctttccgagtcgatagacttctttgtagttcttgaagatccaaaaatatgcattcgattcgacgaattcggatgctctgttgatgtccggcgagatggtacaatctttttgagtaggcgattagcaggcgacggagtggattcatctactttcgatgattttttgcttccaacagtgagcatttgaagctttcgaagaaatccattcttctcgtctgtagaaagcttgtcaaatcctacattcatgttgtcttcttcggtcggctttacactgtccgatttgtggtacttcttgaacaaatcataaactgttgcaggagttggagatttctaaaaatgaaaacttttaaactatttcgaaaaacaaatttacaaacctcgccaactgactcaacaggactgagctttaacgagggcggaattttgttctttctctcggttgatttcgcaacgatagatctttcattaccgatgccttccactcggtcattcaggttcatggtgaatgcttttatcaacggcagcaagtctg