Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0511.3   

sjj_B0511.3RNAiJA:B0511.3
PCR_productsjj_B0511.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0511.3 Source_evidenceePCR786WS150 Sequence/Annotation Release
Overlaps_Gene B0511.3 Source_evidenceePCR786WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681B0511.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1064646210647921
Overlaps_transcriptB0511.3 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0511.31460gtctgcgatacacagcttttcttcttgaaaagcttttaaagtgagttttggccataaagtttgtaactttatcattaatgttttagagttttgtctaatcatgattttgagctgaatttaaatagaaaattacactttttgaaagtttcgaaccgaaaatatgtacatttccttttttcaatttgtttttctttctgttatccaaatttttcgctttgattgaaggtttttctttagaaataattaaatatttcagacaacttcaatatggcaggccaaagcaagatcatcgttggaggagtaatcggcggaacatctgaacaagagtaaattgaattaaaaggttatcgaaaaataatttttttcaaatttcaggccaaaaggatttcttgatttaccggtggaactctaccaaaaaattattggaaaactggatttacacgagaggtgaattacaaaacaatgagtattgaaataattattatgatttttttagatttcgcgtacgaaaaagcaatcaaactctccgccagttcattgatcaaatggatcctgcaatttcacaaatccgtgtgtccatttctgatagtgacagtaaagaagtgaaggtcacgtattttcatgaattcaaggagaagcgcaaacagtatgaagttcactatcagcaagaatcaaatgactgtgtcgtattgaagaatgcgatgattgggtttcaagaagtgttcgagttatggcagaaatgctaagctcgtcgatatatccggatgtgaaaaacatttctacttgtggacttccatcttctcaaattgctcaaattcttccgagcttccaggctggaaagctggaaaatctggatttatactattgtggaaaaccgacggctgaagatatggaaacaattgtcaactctgatcagtggaaaaatgcaaaaaatattagcggatttcgtggtttgagtaatattcgaatcaaggatctccttcatttctcacttgtttgcgtcgattatgcaacaatttcggtggaaacagctattgaaatcaaggatgttagtttgataagtctagtttcgctgaatttcactttaatattatttcagattttgttgacttctagtaacatcaagcatgcatatttcacctcgaaaagtgtcttggacgtcaatgttattcgagtttttgatccgaaagcagccaaagttcatcgaaaaaggaatctttccaatttggtgcgaaacacggattttgcagatttcacattttcgagcaaccaaaaagttctccgtttcaagaagaaaaattaattcccactactagaactgtcttgtgtttgaattgtgtattttcaaaatgaagtgatcagatttttttttgattaactcctaagatggtaattatcttggagagtacatgtgtgttatacattatttaggtaaagatttgataatgttgcaaaggtgc