Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0547.1   

sjj_B0547.1 RNAi JA:B0547.1
Simmer:B0547.1
PCR_productsjj_B0547.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0547.1 Source_evidenceePCR784WS150 Sequence/Annotation Release
Chunk_score Abs_score742
Max_abs_score742B0547.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV56499875651016
Overlaps_transcript (2)
WB_DNA_textsjj_B0547.11030aatgtgcgatacggaaggtcgaaaggagaaagtcgtcggatggtatcattctcatcctggatatggatgctggctatccggaatcgacgtctcaacgcagacactcaatcaaaagttccaagagccatgggttgctattgttattgatccattgagaactatgtctgccggaaaggttgacattggcgcattccgtacatatccagaaggataccgtccaccagatgatgttccatcagagtatcagtcgattcctctcgcaaagattgaggatttcggtgtacattgcaaacgatactactcgcttgacgtcagcttcttcaaatcacaacttggtaggtgaaatttatatttatcgggaatgaattacataataaaaatacgataaaggacaatcaactgtaaaatccaatattcaaagctttgttttttggattgtttaaacttattggaatcgaatagcttgaaattttaaacttttaaaataagaataataatattaaacatctcaacgggaaattggtctcaattgaaaaagaaacatctccgattctttcccgttttaataattaaaattccagacgctcacatcttgacttctctgtggaacagctattggatttccactctcagcagttctccactcttctcaaacgtcgaattcctcaacaatcaaattcaagacatcaatcagaagctgtcggccgtcgataagaagctccaattgaatgacagaagtgtcgatggacatgaagctttgatgaaagtcgtgaccgatgcaaaggcagtcggagatgaacttgaaactggaagaatctctcatctcgtgaaacaactattgtttgctcgccaagctggtggtggctgtggatgttcccatgcttctgcaggatctccaatggatatcgccgtggcaactgaacccgagaaggctggtccttctccatctgctccggagcccgctgttgagatggccgatgcttaattctcgttttgtctatatttataaatcaagtccccctgttttctg