Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01F6.4   

sjj_C01F6.4RNAiPF:GL1_1E4
PCR_productsjj_C01F6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01F6.4 Source_evidenceePCR882WS150 Sequence/Annotation Release
Overlaps_Gene C01F6.4 (3)
Overlaps_transcriptC01F6.4 Source_evidenceePCR1081WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01F6.41677cgtcaacgtctcgaaacagaaccaggactgcgaacgcggagaattttgtctgcactctctccgaagagagtgcagagaaaaccagaaacgggtagtagaccacccagtcggttaactacggtggattggaagaagtgaccagcaagaaatttcaatgtaaaaataagagagatttccatttatttcaattgtaactgtaatggaggtggatccgggttcagatgatgtagaagctgacagagaaacgagagctcagaaactaaaattaaagtaagttaaattttttaatgtttttttttgttgaaattgttttaaattctttaattcacatccagtcaaactaaaatgatcaaaaactaggttttcagaagaaatgtcaaattccgtgcacaaatgagaagattcgacgagtactgtggagtgactaatttaacagtagatgatctcaattggcctttaatatctggaattcctttacaaagacaacgattgacaggagctacgtattatgatgatagtcttctcgatcaaaatccttgggatgaattttcaattgatcgatttcttgaaattacttcaattcaattaataacagccggtgctggatatgaaaggaatgatgaaattactcgattcgtttttcaaagaacaatgaagacaattgtaacttattgcaattttatgtatgatttggcaaggcggaacgggaaagtgtgaggcgaatctgaaattttataaaataaaattttaattttcagtcaaataactcgattcgagttgcaagatttgattcatcgcgatgaatttcggttttacatgtattttcgacaatttttagtgagtttccttgttttatcataaattaaaacaagctctacttacccgatttttttttcgatttttgaaccaaaaaagggatatccgactcgacacgacaatttttagttaaataaaaacgggtgtgtgcctttaataagtactgtaattttaaactttcgtcgctgcggaattttcttagtttttcggaaaattgttttaattaaaaaactaaaattacgcaattaccaaaaaaaaacagggattttaagaaatcaggaaaacatgtaaaaaccggtgaaaatttaacaaaaacaaaatcttgaaattccagtactcttcaacggcgcatttccgtttgtattttactttttttaaaatcctaattccagcccaatccggatccgaattgtacggccttttccaatcactacacgtctcttcttcatacactctatttcaatattccgggaatgccacagttttggaacaattcccaaatgtataattacgctgctacccgtggtcaacgccttgttcaaaatatcgccgctttttatccacccgaatatttttggaacgaagatgaatccaagtatcatactacgtttgtggttccacgtggcacagagttctcaaagttttatgctcgaagatttcatgaagcacttggaatgccaccactggaaaatgagattattacggttttggattggcttgcgaagctctgcattttggaagtaagcattttaaaaatgttatttatgtactcatatattaatttaaagcttttaagcgttaaaaactattttacatttgtagattgtatatcacacaacgatttggtgcgacataactgga