Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01G12.5   

sjj_C01G12.5RNAiJA:C01G12.5
PCR_productsjj_C01G12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G12.5 Source_evidenceePCR812WS150 Sequence/Annotation Release
Overlaps_Gene C01G12.5 (3)
Overlaps_transcriptC01G12.5 Source_evidenceePCR812WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01G12.51122tgagcttgcacttccatcaccaaagatgagcccccatcagctacaatagattgcccaatgatgtaagaagaaagctttcgatccgccaaaaatacaataatattagcaacatctacaggttgagcaatagttccaattggacaacattcttttcgggactccataaatttgtagatctaaatttagaaaatataataaaagttttccatgataatactcctacgttttccaccgactccttattcattcccatagtttcgtagattccagtacgaatatcaccagggctcaccgagttgacgcgcactccgtgttgaataaggtcaattgcagcacttctggtatattgatccagagccgattttgacatagcataatagatgagctcgggttgcttaagtgttttagtcgaaatatggaagaatgttattactcaccgcatgttgcccaccggcaatactggatacattcacaatttctcctttagtttttatcaaatgctcctttgctttttgagttaaagtcaccacacttctcaaatttattctcattgttttgtcaaaaacggaaacgtttgtacccacgccgatatgaccttccaaatcagttattgctgcgccagcattgttcaccagaatatcaagacgtccaaaaatgtcaacagtcgaattcatcagctcaatttgtccagattcagtagccaaatcggcaataatagaaagcacgtgatcttctggaactccggagcgtagaatttcctgtttagtttcttcaagtctctgagcatttcttcccgtgatagttactttagctccctctcgggcgagaagtatagctgtagcgcggccaattccatttgaggagcctgtataattattttcacagccaaattaaacagaataatagttaaaactacctgtaacaagtgcaacctttccagaaaatcgcggcatatttgattccactagcacaataattttccccgcggttcttgtttatatgtagtctccacactaaagcgtgttttgtagttggtggcagataaaatcgtagttaacttgataagcataaaagcatacagaagaggaaacaagattgttaacggtcggattttgatcattc