Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01G8.5   

sjj_C01G8.5 RNAi (3)
PCR_productsjj_C01G8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G8.5b Source_evidenceePCR792WS150 Sequence/Annotation Release
Overlaps_Gene C01G8.5 (3)
Overlaps_transcript C01G8.5a.1 Source_evidenceePCR792WS150 Sequence/Annotation Release
C01G8.5a.2 Source_evidenceePCR792WS150 Sequence/Annotation Release
C01G8.5b Source_evidenceePCR792WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01G8.51490cagaacgtcgtagtcagtgacagcgttctgatctttaacactgtcaagctcgcgagtcaacatatccagcttattcttgatctgaatgttcttctcggctgctgtgacacgctccaactcgtgttgtggcacattctgatcagcgtcatttgtgagttctggaagataaaatttgaagatgatattttttctcataatctctcccaattattttaaataaataaaaaaggcataccagttgctccattatcttcatcatcagtggcagtctcatcgtgagcgtgtccattggaaacgtgatgactgtttgagtagtgttgagtgtgttgttgcgagtgaatctgaatttaagaaaaaataattttgaaataaaataaatccagagttacaatcagggattccgttttttttggttttttcggacaagaaaacatttaaaaaaatgtttatcaaaaattttatgttttagttggtatgacgaaaaatgaacatttttgtttttttttgttggttttttggagaaattttaaacaaaatttgtttgttttttggccgaaatttttgttgcaacatcactgcgtacaattaaaaaatctcgcttttaaagatcggattttttattctttcacaattttttttagttttttctttttgtatctcttttattgttgcaaattttttttttaaattaagcttttttgttacagtaatcaactaatttcaggaattactgcatactttttttcattttaaaattttaaaacagtaatttcagactgaaaattactgctcgataattgttaatacggtatttaaaataatttttttaaagagaattttttgtttctattttagtttcaaaaataaaaaatacctgtgtctgaagttgtcttgtaacagtagtctgtctctcgacttcttctctcatcgaaaaaacttcacgttcacgagcatcaacttggtctctcaaatgacgtctctcaccatcactcattgctttttcggattgaagttgagcagtgagctcacgaagttcgtattccttctgttccaatgcttgtttagccaattgcaattgcttgagttgagcctccaatgagtgaattgtattgtgtgcttcagccaattcaagacgagctctctccatatcttcctgcatttgagccatacgcttttcggcgtcacgttgacgctgttcggcttcttcgcgagcagacatctcctgtacgatcaaaacagatttgagtgaaagtttttttagaaattatttgtaaaaacatgtttcaaaaatttccgcaacttactctggtgagcttctcctgctcggcaatcttaagagcacgatcctctctggcttgttgcttcatttgttgaacttcaatggtatctggctttcttctacgcatgtaaagctcgtgatttcccatacacaaagcaagaatacgtttgttgatacggagtcgtggagcgtagaagacaaagtcctgaaa