Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C01H6.8   

sjj_C01H6.8RNAiJA:C01H6.8
PCR_productsjj_C01H6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01H6.8 Source_evidenceePCR732WS150 Sequence/Annotation Release
Overlaps_Gene C01H6.7 Source_evidenceePCR149WS150 Sequence/Annotation Release
Chunk_score Abs_score128
Specificity_index0.17
Rel_score0.204
Map_statusBottom50_percentile_ePCRI72276027229276
C01H6.8 Source_evidenceePCR732WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627C01H6.8
Specificity_index0.83
Rel_score1
Map_statusBest_ePCRI72276027229276
Overlaps_transcript C01H6.7 Source_evidenceePCR149WS150 Sequence/Annotation Release
C01H6.8 Source_evidenceePCR732WS150 Sequence/Annotation Release
WB_DNA_textsjj_C01H6.81675tcatgtttcctccctctgttttatttgtgtcaaatttcaatttctaaagaatttccgacattttttaatacgtcaaagattgcaaacaacttctaaccttcagtttcaaacttttaaattttcaaaattctgtcaatgagtaaataaagttcccatcaaacatgttttcgaaccaacaagaagtctagattatatcaaacaggattcctattctttgtatctctacgtctacaatgtctcttcttttctcaagatcagacgatacgaggaagacgttgaaacgagactttcctgcgtctcttctacatatttctcgatgaagttttacttattgatttccgttgtgtaagttacggaatgcatccgtgctggaattttgaagctaagttggtttcagatctttcatatcattcactgatagttgctctccagatgtcaaatttgaaaaagatcatcatagaaggtttgtatctgtgatagacatcaaaattattttttagtgaggatcgttattgtggattttcttctgattacccaaaatagtccgaaattcagaaatcgtacaaaaataaaaatcatgtcggaatacataacaaaaaatttttttcgattttttttcgtaaaattttttttaactttggctattcttcctggtatttttgaatctcagacaatttcaaattgttagagaattgttttttatcttaggcattcacaatgtgtaatgatttcataaagttgtttcagaaaagaattggaagataaattcataaccaatctggcagaactgaaaaatcatgaagaagtccttctaaaagcagttgaaatgatgaaacatgcaaatgaaaaaaaggatttagatgaaaatgaactggattacaaaaaaagaattgctgaaattgaaaaagaactgaaagcgacaaaagatgatcatactagactactgtaaatatatttttccaaacttttgaaaattttaaatagccattagaaaaatcaatctgaaaatgaggttacacaagtaatgttacccattattgcaaaattccaaataagaaaaatcggtcgtgtcgagaccaggtaccgtatgtttgatgaaaattgcaaaatctcgtaactgagcagaatgtgatctggatttcttgaagaaagcaattcttgtaattccctcaatttgaaaccggaaggatttcagtttttctctcaaattaaaaatttgtttcagagaaaaacacgaagactatcttcgaaaattcgaaagtccaagaacatggtcagaaacattcagtaagtatactggtgacgcatttggacgtcttttattcaatggattatggggagctattgtacttttacttccacttcttattcgaccatttcaacgtagatggcttacagctctccgtggtggagatggaccaactattgaagaggttactggtatgtgcatggctactgaatcattaaaattcagattaacttattttaaaaacgctaatttcgaagatctgtaaccaagcttcaaataatgcttgtattgaaaaaattgaaacctttgataaaataatattttcagagagtgatgatgatggcatgagaatatcaaatgaagaagttcgtcagattctggattctgagaagaaaccgaaaaggaaggcagtcaaagctgaataaa