Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C03C10.3   

sjj_C03C10.3 RNAi JA:C03C10.3
Simmer:C03C10.3
PF:GL1_1A7
PCR_productsjj_C03C10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C03C10.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
Chunk_score Abs_score906
Max_abs_score906C03C10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII40935494094629
Overlaps_transcript C03C10.3.3 Source_evidenceePCR969WS150 Sequence/Annotation Release
C03C10.3.1 Source_evidenceePCR969WS150 Sequence/Annotation Release
C03C10.3.2 Source_evidenceePCR969WS150 Sequence/Annotation Release
WB_DNA_textsjj_C03C10.31081atactcggaaacccgcttctcgaagaagttagtctttccgtcgatcgagatattctccatgaagtcgaatggattcttcgacttgtaaagcttgtcacaaccgagctcgacgagcaaatgatcggcgacaaactcgatgtactgtgacataagacgacagttcatgccaatcatgtcaactggaagtgcctcagtcaggaattcttgttcgatggccacagcgtccttgatgatatcgtagatgcgttgttgagtgagtttcttttgaagctttgagtagagaagacaggcgaaatcacgatgaagtccttcgtctctgcaaaaattatcaaattacattaaaattatttaaatctcgtaataataataattacctcgagatgagctcattggaatgtgtcaatcctggcatcaatccacgcttcttcagccagaagatcgaagcgaatgatccactgaagaagattccctcaacagctgcgaaagcaatgagtctttcagcgaacgaagccttcttgtccgaaatccagcgaagagcccagtcagccttcttcttgatgaactcgaactcatcaacggcgttgaaaagagtgtttcgttccgtctcatcacgaatataagtctcaatcagcttcgagtacatctctgaatgaatgttctcaatggcaatctggaatccgtagaaaaaccgtgcttctgagacttgaacttcgttcgagaatcgttcgcactgaaaatttaatcgttaatttgaatcattattgagatatcaaataaaacataccaagttctcattgacaattccgtccgatgcggcaaagaaggcaaggatccgagaaatgaagtattgctcgtcaccattcatcttctcccaatcgttcatatcctttccaagatcgacttcttcgactgtccagaatgatgcaactgcctttttgtagaagttccagatgtcatgatgtttcagtgggaagatgacgaatcgattatccaaatcttgaagcatcggctcgtcggcatccagctcattcacctccgactcattatttgtttcctcagctgaagcagccttggtctgatc