Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C04F1.3   

sjj_C04F1.3RNAiJA:C04F1.3
PCR_productsjj_C04F1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04F1.3 Source_evidenceePCR673WS150 Sequence/Annotation Release
Overlaps_Gene C04F1.3 Source_evidenceePCR673WS150 Sequence/Annotation Release
Chunk_score Abs_score611
Max_abs_score611C04F1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI57202845722401
Overlaps_transcriptC04F1.3 Source_evidenceePCR673WS150 Sequence/Annotation Release
WB_DNA_textsjj_C04F1.32118aatgaagcgtgaaaactatccaacatttttatatggggattatgattactgtatttgactatagatgtgaattacgcatgggattaggtagtgtgcaagaatatgtaaccaaattttgaagtgagtgtcaagtgtttcattctccgagttactgtcatatttgcacagattttcttaccaagttggtaagacaggcctacagcgaatttgtcaatattttttaacgtttgaaatttcaaaaatagacagtgattttttaaaagtattttttaaaataaatttcaaaaatagcgaaacatacttgacttgatagcaagcatatctacagccaaaagctaataggatccggtaaaattgctagctttgcactaataacagggtgaccacgctaatttgccgccgaaatcaaccggaagcgttcacgtaatcactataaaaacggcaccgcctggagcatcttccttcctcttctaaagctcgccgccatctggcgtctgaaggtgtgaaaacgtgaaaacaaccgaaaaggggagaaacggaaattgtgacatatatacaaacatacagtgctcttttcatatatttatttcaggttatttacaacacgttgctctcgatgccatggagattttgacaaaactgatctcgtgatgagggctggaccccaaaatgtgttccatctcaactgctttgcgtgtgttgcctgtgaaaaacgattacaaactggagaagagtttcaggtgagatatatttgtattcttcttattattgaaaaagactatcacaatcttataatattatatattataatagtaaccattcggttgcataatatttgtctaacaattatggaacacattaatccttgcatctaaaaatatattacagatcaaaaataacagcttatactgtcgatcagactgccggggacttgacaatccagatacatcagcttcagttccagattattcaaaattgaataacaataacaacaatgataacaacaattcaagttcaaattttgatgaggatgaatgggatgaggagagatccacattgacttcacttgacaataacacatcaagtcctttagggtaattgaattgatttaaacaaaacaaaaaagcaataagtgctttttcgagaagagccaggtgttttttcactccacttgacacttctatttaccaatattaccttatcgaaagtgagcatgaaggagttgcttaatctagtgagcaaatgcacctggttggcagcaacatctgcctttttatctttaccgcctgtgatcatgtatttggaatataaaaaggtggataacacgtgttgcttgaaatcaaacagcactgacactgaattttaataaaaaataaacttattgaaaatgtttgatttttttcagatctcccaaatccgatggagtccgaaccccacttttcggtcatcataacagtggttctggtggctcaacgagtagttgtggaaaaaagaaaaaggataagcaagcgacacgtgtcaggactgtgctcaacgaaaatcagctcaaaattcttcgagactgctattcgattaattctcgacctgatgcaactctgaaagaacgacttgttgagatgactggactcagtgcacgagtgatacgagtatggttccagaataaacgatgcaaggacaagaagcgacaaattcaaataacagagaatcggctaaactctgaacgagtatgttttgatagcaagcctacttcaatgttgtattgtgatcagcaacctcctctttctattttctaactttcatttatttatgaaactttgatactcggttaaaaggggaaatatcatcaagatattcgtataaattgcgatgccatattcatttaaaaatcaaacctttgatgatattttccactaccactgccacttttttctcccactttctttccaatatcttttcaatttaacataaatattctgtgataattattgtgaatataaatatgtaaatcgcataaattttccttttccagcttcacatacacctacagtaacccaattagtgaattgcgcattctatgtgtgtgtgtctatgtgctcggctcgtaattagttttgattg