Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C04F5.9   

sjj_C04F5.9RNAiJA:C04F5.9
PCR_productsjj_C04F5.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04F5.9 Source_evidenceePCR867WS150 Sequence/Annotation Release
Overlaps_Gene C04F5.9 Source_evidenceePCR905WS150 Sequence/Annotation Release
Chunk_score Abs_score863
Max_abs_score863C04F5.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV51144135116067
Overlaps_transcriptC04F5.9 Source_evidenceePCR905WS150 Sequence/Annotation Release
WB_DNA_textsjj_C04F5.91655cgctgaaattttagggaaattcttacattttttaaactattttttgtcgtttcgagtaaaaaaactattaaaaaatagaaaaaataataattgtgatcggataagagacacgaaaataaaaatattttagttcaagaatttagaaaaaaaattttatttagtaattatgacagaatatgttagattattattcttctctttccagaaccggcggatcaccaaattttttcggattctcactaaaaaaggttttcaggcttccatcagggttccgcaacattgaatattccatatctgtgagtagaacatgctgtttcagatttccgtgaagtgtcacaatattgttcttctgtttcttcacatttctcgatacatttattccattattcttctccaaatatttgcccattcgatattcttgtccacttgaatcgtagaattttgcctcttggaatttgaaatatgggagaagtgaggtggcagtgattgtcagttgattacgatgaacggggggctccctttgatggacagtttgttcgtgttgatagaggaatcgagacgatttgaatgttatttctgaaaaaatataatagttcaaattgccggtattgaaatttccggcatgtcggcaatttgccagaattcaaaatttccggcaaaccggcaatttgccagaattcaaaatttccggcaaatcggcaatttgccgaaattgaaatttccggcaaatcggcaaatagggcaaattgccggaattaaaaatttcggcaagtcggcaaactgctggaattcaaaatttccggcaaatcggaaaattgccggaactcgaaatttccggaattgaacattccagcaaatggacagattgccggaattcaaatttccggcaaaccggtaaaatggcggaattcaattttcccggcaaatcggcaaattgccggaattcaaattttcccggcaaatcgccaaattgccggaattcaaaatttaaatttccgcaaaataggcaaattgccggaattcaaattttccggcaaatcggcaaattgccgggaatgataattttcggcaagtcggcaaacagacaaattggcgaaattaaataatttttttcccaaaaatttgctttttttttggtacttttttaaaataacttttaaactatttaaaaactcactacataaccgacaactattcattttcgtgtcaatttcaatactatgagccggaacgggtctattaagaacaatttgtgatgatgcataaccatgtggttttcttctatcaatttgatcgagaaattcttttatgaatttcaaatttgccgcttttttattctcaaagagttcgatccaggtgctcttctcattttccacaaccttcattaattcctcagcgctcattttcttccgttttttctcatcaggtacctcgactcgcattggtttacatccgcttctcaaatgtgccagcagaattcgattttcagcgaatttcatccgacacagcttacacacgaatccaggacgggcggttccatgaaaagcgtgggtgtgttgatccaggcgacccaatgagtgaaaatatcgattacatttcgggcattcttcggtacttgagacattttcaacattccaatcctgtagatcaaagga