Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C04H5.6   

sjj_C04H5.6 RNAi JA:C04H5.6
PF:GL1_7G3
PCR_productsjj_C04H5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC04H5.6 Source_evidenceePCR881WS150 Sequence/Annotation Release
Overlaps_Gene C04H5.6 Source_evidenceePCR881WS150 Sequence/Annotation Release
Chunk_score Abs_score839
Max_abs_score839C04H5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1455992814561001
Overlaps_transcriptC04H5.6 Source_evidenceePCR881WS150 Sequence/Annotation Release
WB_DNA_textsjj_C04H5.61074cagtcttctccgatgtgcaatcctcgaaacgaatactgtagccgacctggaaaatggaagcgtttcgaaagaaaaatcggaatctgttttcctcgtttttttacaagtttaaaaatttttagaagcggcaaagaattgcccaaatttttttaacttccagtttttttttctaaattttggaattttccgactagaatgaaacttagtttattttcgccaatttccaaaaaccacccaacctgagtgcccagcttgcatccaacttcatcagcaactctagcggcaaccgacattgcggcgacacgtctcggctgcgtacatccgatacgcttcccaccttcacaaaatccagcttcataaagatactgtggtagctgtgtcgtctttcccgatccggtttctccctcgataatgagcacttgatgctctttaacagcttcgatgaaagcatcacggaatgcgtagaccggcaacgactttctcgtttcttcaattgacattttctttttctcggcttctgtctctactacttcctcattggttccaggcatctgaagagcctgaataaagtccactttctcatcaagcaacagctcaaactcttgctccttccgcttcgcatccttggctcccaggtgaagcatcgaggccatcagctgctcctcttcccactttgcaccatcaccgcctggcctgaagtcctcctcatcatcctccacgtactgtgaagggatctgtttcgttgaggcgtccggcagatgatatctcttcattttcatgacgtcaccggcttttccatgggctttcgtgtattcgagaacttttttccggtactccatatccgctttttcacgtttcgtgagcttctccctagcgaatagagtttgatcatcgtgaactatcgcctccagttcctccagcttgtcgacttttcgttttttcaggtactgccttctggactcctctcggagtttgtccatggaggaaccctctttgtccttgttatcatctcgctttttctccataacatttcgagttttatccttttcttttttgttaattcgtgctgccaag