Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C05A2.1   

sjj_C05A2.1RNAiJA:C05A2.1
PCR_productsjj_C05A2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05A2.1 Source_evidenceePCR729WS150 Sequence/Annotation Release
Overlaps_Gene C05A2.1 Source_evidenceePCR812WS150 Sequence/Annotation Release
Chunk_score Abs_score748
Max_abs_score748C05A2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1070571910707151
Overlaps_transcriptC05A2.1 Source_evidenceePCR812WS150 Sequence/Annotation Release
WB_DNA_textsjj_C05A2.11433cccgtacgactgacgtttttctcaatacgattaacactagaaattgttcaccgtacacacttatttcctttagattccattcaaatgtgtgacaaaagtatgttgccaaccaccattttaatttcaaagtggaatcaaaaatcgggagaaatccgataattgctatttccatgttttttgattccataaaaaaatgaaatctgccaaataaacattaaaactaaaacaaaactaacaaaatattttcagacgatcgtcctgttgttgtgctataaaatcaagtacccgaataactttttcttacttcgcggcaaccacgaggtggccaacctcaataggatttatggattttatgacgaatgtaagtggctggaatggatgcaaaatgaatggggcaaatgcgaaatggaaattaatagaaatgtagatgatcatcatatttttgagaaatagatataaaaatcaaaagatgatcggatgaattattaatcaagcggaagctcgcaaattgctaataatttgatatttagcttaatttgcgcacagaaagggttttataaaataatatatttcatgatcactttttttgaatacaaattagatgatttttaaatagagacaactgtctcgttgtgtgaaacattttcagtgaaagtttttcttgagtccgattccaatattttccaggcaaacgacgatacagtgtgaaattgtggaaatgtttccaagatgtctttaattgtatgccagttgccgctctaattgacaataaaatcttctgctgtcatggtggtctttcaccaaatcttcggtctctcgaccaactcaaacgactttcccgtccatgtgatgttcaggaaacaggtcttctgtgtgatgtactttggtctgatccagatgcgacagttgttggatgggcaccaaatgaaagaggtgttagttatgtattcggtgtagatgtccttgctcaattccttcaaaaaatggatttggatattgttgttcgtggtcatcaagtagtcgaagatgggtacgaatttttcggccgacgtggattggttacggtattctctgcacccaactactgtggagaatttgataatgctggagctgtaatgaatgtcgatgaaaatttgttatgttctttccaggtaaaatgtgatttttgagaaaaactaattaaaattttgatttcagattctcaaaccccaatcgcaacttgtaatggatgcagctttggctgagaagcagaacaattttgtagcgaatctcgcaggaatggcaaatattaaaatagaacaaaaaccccagccaatgattcaaaaacggtttcgccgtggaatgttgtaaatagtatagaaaacttctgtctagttcatcctcttctcattttttagctttatctgaattaattcagttttcctccttcccct