Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C05D11.9   

sjj_C05D11.9 RNAi JA:C05D11.9
Simmer:C05D11.9
PF:GL1_7C4
PCR_productsjj_C05D11.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05D11.9 Source_evidenceePCR804WS150 Sequence/Annotation Release
Overlaps_Gene C05D11.9 Source_evidenceePCR804WS150 Sequence/Annotation Release
Chunk_score Abs_score720
Max_abs_score720C05D11.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64276026428716
Overlaps_transcriptC05D11.9 Source_evidenceePCR804WS150 Sequence/Annotation Release
WB_DNA_textsjj_C05D11.91115gaatcgtcacatacgctggatggtagtattttgatgtagagtttctgaccataactacagtttttgctgaaaaatattaattattcaatttcaagttaaaaaaaacttacatttgtgataattcgaagcaataagagagagggtattcgcacaaatgtatccaataccaacaccgtgtccagcaagtacactttgttctccggcaaccagtcgaccaattatctcactgcaattattacaatacgagaatagtaacggaacataaattcataccgattggcagaaaatctgtactttgtcgccagtttttgtacttcttcaacttcagcttcttctttccgtttttcttgctcaatctttcttcgttttttcgactctcgcttttttcgattcactcgttttcgtttggtggttctgtaaaatattggtatttgaaccatgtgtttctacaaaattttgcaaaagttgacttttaaacactggtattttggcaaaatctatcctattaatcgtatgatttgaatttaacttttttatattcagaatttttaaaaacaggttttactctgataatgtttatgaaaacattgaaacgtttttatactcgataaatcttggttttttttaaactcacttatcatccaatttcgtagtctcctcaaaaagtaatttcaaattaattggtttttcagacgcagctgcttcaagagacataaatccttgattctttttaactgtaatttcttcaatttccatagcttcaacgatatctgaatcttgagaagaagcttctggaggtgtttgaataatctctcggtttcgattctttcgaattgaaatcaaatcatcatccgttggcagacacaccattccatactttttcggtcttcctcttccaaaaaactgaagtttcactggaattagcataccaggttcttgaaattcttcgagtcccgatcctttcttcatagcttcttcgataatccgtaatttttgaagatctcggcatacaaaagcttcacttctaggtttattggataagttccagtcctgagaaagctcatcccatttaaattcaaatggatacttcactgatacagcactccaatgcttgc