Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C05E11.2   

sjj_C05E11.2 RNAi (5)
PCR_productsjj_C05E11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05E11.2 Source_evidenceePCR443WS150 Sequence/Annotation Release
Overlaps_Gene C05E11.2 Source_evidenceePCR443WS150 Sequence/Annotation Release
Chunk_score Abs_score338
Max_abs_score338C05E11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX45868884588017
Overlaps_transcriptC05E11.2 Source_evidenceePCR443WS150 Sequence/Annotation Release
WB_DNA_textsjj_C05E11.21130tgaaactgaaattcctatcgcattttttattgtttgccgtgagttatatgtatagagcctaaaaagtgaagaaagtgtatcaatttttaaaaattgaaatttcagcttgtaagccgtcctgaagcttcacctgaaacgcgatttgttgtgggagtcatcgtgttgttaaaaatccggtaaataaatcagatataataaaatgggttattgataagccataatcaggaaaataaaattccaagatgtttatcgtaccgtatttccgctactaattgtgcacaattgctaattgaaaagtttttttctcaaaatttgtaattgcttatgtatttatttgtcttcaacagatatattatcttttatagtttggataataaattatatatttttgttatcgactattttgtttctttagtttaacgttttttatgttgcaaccctggaacaaataaaaattggtcttgatctaagttccctaactctaactgttttaatttgacagcttttatcccggttacgtccaattcatcaatttttgagttgttacaatacaactgaggaagtaaaaaaaagttttacttcacataaaaattttgtttaatttttccagatggctcatcaaacgaactttccttgctagaaaacgaggagttgtggtttgctacgtaatgtttccaggtcaaacttttttgaacacggcagcgagtacaatccgatatgtcacatttatgattaaatgtttccttattttaatagtaagtttttgatacgcacatcttggtatgcttttcaaacacattttttcaattttatcagcatacgcacaaactttttttcagtattcttgtatcattgtctacctgtccgacaaccctgctaacagaaacaccgttgcagtgtacacattgatgtagggcataaatgaaatgatttttttttcatttttaataattttcagttttgttctaatccattgttgggagcaattcttgtatggcttctacaaagtcggcgtttcgttgattagaacactttatgttgtcaaaattgaaattgaatccaaagttgtcttataatttgcatgccatgttttatttctattctcaattccataataaatgcgctttgtt