Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C05E4.8_b   

sjj_C05E4.8_bSequenceTAAAATTGTCCTGAAACGCCTAA
In_sequence (8)
PCR_product (11)