Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06A5.1   

sjj_C06A5.1 RNAi JA:C06A5.1
Simmer:C06A5.1:Screen_A
Simmer:C06A5.1:Screen_B
PCR_productsjj_C06A5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06A5.1 Source_evidenceePCR878WS150 Sequence/Annotation Release
Overlaps_Gene C06A5.1 Source_evidenceePCR878WS150 Sequence/Annotation Release
Chunk_score Abs_score815
Max_abs_score815C06A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI60123236013483
Overlaps_transcriptC06A5.1 Source_evidenceePCR878WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06A5.11161acaatccagccatctcgttcgccccaatctcgatgatcaatggaaagattttggagatacaatcaatttaaacatcgaaaccttccagaaaagcgtacaggaggcgattttagcgggccattttacaaaaatcgctaaaatgttcgtcgccgcgctcaagagcttctttgtcggagaaaagttgaaagtggagctcagaataatgggaacaattgcggaaaccgtaaaaaatcatggggataagctaaatgttggttcaaatctaacaaaaacttggagaataattctaatcattgaaaaattttcagcaaattcctctccaccgcgctctgctcttcgtaatttgcaattctcgatcatatcctgacaatattctcgaactattcatctcaataatcacttcacttgcaaggcaacaaccaattcttgataaatgttatctaacagcatttctccatgattctattggaatgagcgttggactcggcacaatgaatcgatgctcctggattgaaaaagagtgctcggcagagcttgtgaaaatgattttggatccgtttgaaactgtctatccatttccggcaatgtatgcgcagtgccaggttgagaattttgccatttccgaatttttgagcttcttctctgaaaaagtggggaagtcgagggaaaaaaggtaataaatttacgattttttagaaaaaatttcgcttatatttttcctaatttaaacagaaacaaaaagcagcatctacaaacaacggtgtaatactagctgaaaagcatttaaagtttatcaaaatctcagaagaaatttttattctgtgttagaaaagtggaaataaaaaaaacagtttaaagaataagtcaaattttaattttaatacatttttgatttcagtccccgctcgaatcttcaccaaaagcagttagacgtctttctggaattcctgaagccctggttcgacacaattcgcggtgaagttcttccaaaacctcttttccgtgctctctgccttctctgtggctacgagcacattcgtcttttcattgcgaaccgtctggaaatttggataactcttcagaaattccatcgagaaatcagtgagcttttgctagtgatcgggtcgaatattaacgcggaaaaccacgagttggacaagg