Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06A6.1   

sjj_C06A6.1 RNAi (5)
PCR_productsjj_C06A6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C06A6.2a Source_evidenceePCR916WS150 Sequence/Annotation Release
C06A6.2b Source_evidenceePCR925WS150 Sequence/Annotation Release
Overlaps_Gene C06A6.2 Source_evidenceePCR1123WS150 Sequence/Annotation Release
Chunk_score Abs_score1018
Max_abs_score1018C06A6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV78515107854254
Overlaps_transcript C06A6.2b Source_evidenceePCR1123WS150 Sequence/Annotation Release
C06A6.2a Source_evidenceePCR1114WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06A6.12745tcctttcttgatcatcatttcgttgacatcctatatgagatttagtcatgttttgtcaatgtgcataagtaaatactcagtgacagcagctggatttctccgatttgacctttatccaagatgtattaactgtaaataagaattaatattgccaaattgtttccactcgtaaagttttgattatttctcatttcctattggagctcctcctactactcactttcagcatgagttttaatttttcattcattttagaagaaaataagagaatttgcaaaattagggaaatacatttttggattaatcctgtaatacagaactttaaatttcctgagattcactgtactgacatgatttctaaaataaaaatgtttggaccgtatttcgaaaccttttagtattccaaaactacgtggcttcataattttcatatacaaactcaaaaacgtgagaactcttttttcatttattcctttctcttcttcacagtttcccacatcgaccataaaccctcggagacgagaaaaacgaatgatacattcgattcatttttctctcctgtgatcttccccgcgatgactctcatgatgagcagtatcgtttgattcacgccgacactttgcacccacaccttttttggtcattaggtggtaataaactgtagggtaccgtgctcccctttgcagactcctcctatcttcactattgtctcttagatagtcttcttttagttattggttttattcaacaactgaatgttctattttctttaataattgaggatccattaaattatttccgttcatatcaatgaaatatttgagcttcttaatttcagaaccatccagctcggccggcttatcggcacgtctagcaattgcatctccatctggatcatctcaaagtgaagattcaaggatggctgcatcttcaccatcaactgctttcataggaatgccgactacaatcaatggaaacaagtcgatacaaactgtgcttgataatctaattgctgccagatccaaaaaagaagatcatgctgcttcaacgacatcagttctacaagctccaaactatagtgaattgaagcaaatgttggaaaagaacaatatattgtaagttgagcagtgggattgaggaaatgaggagatctttttccagaaaagtggacaatgaaaatgggccaccgttaaaacgagtgaagcaagaaattgaatcacctccaggaagttctcgaatgatcgtgtacaatgataccagaaaaaccacaaacgcagtgagttatcaaaaggatcaaaaaatcttaacttgaaagcttctaatgaatacctaatatttccatcttttcagccaatatcaacatgggttccaccaagagaagatttaacagcaaaagtaaaggatgaaacagttcaatcagttccacagagaaaagcacaagcaactgctgtaatcaaaagtggatttccactcgaaaaacatttgaaaaaagtgagtgaaacaggaaattctcagtcagacagatgtctaaaacaaatctctagatgattcagcaagccgttccctcgatgatcccagtaaccagctcatcgattcctcaacgaaatggcattctcggattgaattctatgattcttccaccgtcggctattcaacaagcacttttgaagaaaatggatgttccaacaacaacaccatcaatgtcttcaacttcatcttctcaggcacaatcatcgatgaatggagtaattaatggaaataacaccgaagtagaagataaatggacactgttgggtcagttttatgacaaaaatagctgaattaaaatttcaatcatattttttattaagcaaagtaatgtgcacagttgcattaaaggtggactacggccaatgatgaaataattaaaaaatcctaataaaactttaaaaaatttcaaaaaaaatttacttcgagtcaagagggaattttccgagcggctgaaaataaaaaatatttccacatttttttgaaaagtctttttaaatatttatttttaattgattatatttagttattttagaataataggaatggtttttaatcttttacccattggtcgtgctccagcttcaaaaggcttctctacccccaataaatcgaagccttctccttaatcctagcaaaacttactctacaactaaaagagagattaatctcaacatcatatttgcaaaattatttaattattattattattttaggccgaatgattgcaatgatggctcgtgaaatagagacacgtgatccaatgtcagcatgtgaactaacaagagatctacaacaagtcatattccaatacaatatgaaaactcttcgccccaaagagaataatagttcatcttcatctcaataatttcaatttttctctaatttttttcaatcctctccttacgtgtacattgccacccgtctctcaattttccctttttctatgggactttaaacattttttgttcttgtttatattattattagtttgacattatcattctttcctcatttttctgcattttctaattatttttcgattttttgttcacataaattaactgtattcatcgccgcctcttgaacctgaaagtagagccaattcataaaatttcagctaatttcaaaatgctccgccccaatttcgttcagtttctttacaactgcatttgtagattaagttaacaacgtcatcacgttgagaattcggactta