Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C06B3.3_f   

sjj_C06B3.3_fSequenceCCATGACTTGGGGATTGTTC
Length20
In_sequenceSUPERLINK_CB_V
PCR_productsjj_C06B3.3