Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06B8.2   

sjj_C06B8.2RNAiJA:C06B8.2
PCR_productsjj_C06B8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C06B8.2a Source_evidenceePCR778WS150 Sequence/Annotation Release
C06B8.2b Source_evidenceePCR881WS150 Sequence/Annotation Release
Overlaps_Gene C06B8.2 Source_evidenceePCR881WS150 Sequence/Annotation Release
Chunk_score Abs_score711
Max_abs_score711C06B8.2
Specificity_index0.788
Rel_score1
Map_statusUnique_ePCRV1547896915480564
F22B8.4 Chunk_score Abs_score191
Specificity_index0.212
Rel_score0.269
Overlaps_transcript C06B8.2b Source_evidenceePCR881WS150 Sequence/Annotation Release
C06B8.2a Source_evidenceePCR778WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06B8.21596gtagagccaggaggaaacccgaataggaaaacccctgttatctaaatttcaaaatgcctaatacgtccgttcaactacaccaacattctttgccatgaagtaactgttgtgatctcgaaattgatttaacagcaaaatattgattgatgactgatcgtaccgaaaacatcctgcataagaattccaggtgggaatgatgtcgcacttcagtttcgctgccggcgggttcatacatttttcttctaatgcgcaaagggtgtgcctggaattttttagaaggtaatgtgtttttaattggacaattttccaagcaagagcatgagaaaaaaccctaccatttcaaaatctccaaagtgaatggagttcgagccaaatagaccagcattgcagatacttgaaggcctttttcgtttgttttcagaacatctgtgtcaaacgtgggaaaatagtcaagaagtcctgaaaatcctatgtttctaaaattcaaaccaagacaacggaccatttgttagaactgcgtaattgctgtgcgttgagttgataaatgtttgaattgaggagttctgaaaaaagatttgaataaatacgcagccgacatcgatcgaggtctgcgataacctccgcagtaacgagctgattactggaagagtacggtggaagcagtgtcacatttcggtttgttctaccttgacctacaagaatcgcaggaatttagacgcagacttctcaactgatttcgcatgattaagaacgtgctggcgtcgcacttttttggaggaaaaattcccgcatttttagtagatcaaactgtaaatggacagcctgacaccacgtgtggaagcactaaaagctacctctgattttctacaaaccttcgtacagttaacatcgttggcgcattctgccagatctccataaactgtatccaatgaatttggatgaatccattttgtatgggcatcaatccaccaaacattcgcataatcccgaatcgcttccttcaaaagtctgattctattctcctttttaaaccaaaactcacagcgagaatcaacgctttgaaacgatattccatccagttttctacataattcggatacttggaataatcgaatttccgaactttgacagttggcctcttctcgatgtcaagtatttgagcgtcggtaagatccaaagaatagagaatcatgttttgatttggccaattgcgatgcacaatgttatactgaaaatgtagcattaagatttgttcaactgaattaattcgagaaattatgaaaaaagtctcaaaatgaactcttaccatttcattgaagttaaacaggtggttttttgaagtggcagatacaaacataatatctgaatcatttttaacaggcctcttcagttccaccataatctgttcgtgtgatccaatgagttctggaaaaaaaatagtttaaaaactaagtaaaaaaagaaaaaaaaacgactggcgtggcacgagtaatacaagagaaaaagacaggcgaggagaacctccgtgtaacttactcaaatcctccaaaatgcttaaccaagtgcaattgaaccgcttcccaaccaacgaaacat