Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06C3.1   

sjj_C06C3.1 RNAi JA:C06C3.1
Simmer:C06C3.1
PCR_productsjj_C06C3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C06C3.1a Source_evidenceePCR1059WS150 Sequence/Annotation Release
C06C3.1b Source_evidenceePCR1059WS150 Sequence/Annotation Release
C06C3.1c Source_evidenceePCR1059WS150 Sequence/Annotation Release
C06C3.1d Source_evidenceePCR1059WS150 Sequence/Annotation Release
Overlaps_Gene C06C3.1 Source_evidenceePCR1059WS150 Sequence/Annotation Release
Chunk_score Abs_score954
Max_abs_score954C06C3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII93606489362342
Overlaps_transcript C06C3.1d Source_evidenceePCR1059WS150 Sequence/Annotation Release
C06C3.1a Source_evidenceePCR1059WS150 Sequence/Annotation Release
C06C3.1c Source_evidenceePCR1059WS150 Sequence/Annotation Release
C06C3.1b Source_evidenceePCR1059WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06C3.11695aaaaggagccgatgtgaatgcacaagataatgaaggatggacacctcttcacgcagctgcatgttgtggaaatgtggcaatagtcagatatttgtgtcaacatggagccgatctctcaatagttaatagtgataaagagttagcacttgatcttgcagtagatgaacaatgtcgtgattatcttgacgatgattacaagcgacaaatgattgatctcgatgcttgtagagatcaagaacttcagacaatgttgaaagatgtgaatatgtggatgagtcagggagaatatcgagatattcctcaccacagaacaggtggaactgcaatgcatgtagctgctgggcgaggatacacacaattactcgaattacttatcaaagcgggtggaaatgtacgggcacaggatgtcgaaggatggactccgttgcatgcggctgcacattgggctgaacgagatgcatgtaaaatattattggaaaatggagcggaattatcggatctaacgtttacggtaggggtttacagtttttctgttgcggttttcaagacctggcgcctgcttgaaacctaccagccactcgcctattttctgtattctggcgtgaattttcaaatttcttatcttcgaatttcaattcgatgaaaatcaaatttaaaaaataaatgaggaaggcagaggtcgccttaattaagccaggcaggcgtttcgacgccgacatggaagtcctatcaaagaaaaacgacaacaaaactgaatttaaaaacatttgtcataccaaaatatgttttttcaaagataaaaaatattatttactgaaaaaatgtacaaactttatttttatcaaaagtatataaattcacaccaattgctttaaatttttttaaatttttatttaaaaaaaaaacaattttcagggtgctgacgttcttggagtagctgataaagaatgcatcgattatcttgtcgagttggctgacactgtgaaagtacagaacaagcgaaaatcaccgggtagtggctcccagccaccaacttcaatacttcaggagaagaatcatagaatgccgtcacacgaggaacatgttctgacaagtgaacggaaacgagatttacagcataaggatcagcataggtgggggtttagaaattaataatttgaaaatttaatattggaaagttttattgggaaaaatctgaatcagaatttcctcaaaaaaatattttaaaaacattgcatgttcaccctcaattattccactatatcctatcgcttctctatttttttgtctatttttttatatttctccagtgaaaacgagtttcttcactcgcatccatccactgcatcagttggctcgaccacatcatccaacacaaataccaccacaaccaccattgttatcggtgaaaatgatatttctgctgcacaaaaagattcaagagaatcatcgaaagaatcagctgttgatgatgaagaatatgtcgcagaagatgaaatggaagaagctgaagaagatgaagaagaagaagatgttgaagaagaagaggaagaaaaaagtgaagctgaattaaaaaatggaaaagaaatttcaccgcttcgatcggaaactacaagttcgaggagtatatctataacgaggtgagtgagcaggcttttgagctggaaatttatgttttctcctgcaatttccacc