Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06C6.2   

sjj_C06C6.2RNAiJA:C06C6.2
PCR_productsjj_C06C6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06C6.2 Source_evidenceePCR899WS150 Sequence/Annotation Release
Overlaps_Gene C06C6.2 (3)
T10C6.2 Chunk_score Abs_score72
Specificity_index0.085
Rel_score0.093
Overlaps_transcriptC06C6.2 Source_evidenceePCR899WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06C6.21191cccacttggtttgcagagttggcagatttgcataatttcaaacagcggagtgttgctgaaaatatataaagaattaagttttccttggatacattcgactcacaaaaaataaactctcggtatggttttataatgaaaattgtgggaagcgcatcagtggctaggtagaaggaaattgttaattcctgaagatgtccgaaaaatggtgtagaaatgttggcaaacaaggtaatataaattgcagaaagtgggatttgcatgaagaaaataggaatcacagcctgggacacgagcgcgtagaacagttgccattgaagcttttgaaagtttgcggagtaagcggaagtcatgagggactttgtgacgaggtaggattttagagcaaagtagagcattagagattcggaaccaaatagaatgcaagtacagagtgacatgccgatgaatgagtcccagttgatcgtggtacttccatctgctagtcctgggtagaaatatactgcaacaaacccgacagttttgttttccagggaaatcgggtaggactgttggctgaaattatttgttaaaaattatgctgattatcataagtatgtgccttattgcataaactacataatcatttcttcctaaatagattgaacaagaaagtgtccacataagagcaacaagtagaggaatgcttccccaaaaaaagaatgtgaaggagcttcgtgaagtccaaatagagtttctgagcaaaacatagattttttggaacaagttggaacctctcaccctttgagcacctgataccgataagcaaattgaacaccaaacatggccaatgatgtggcaaacgatccacagtagattactgaaaatgttatttcaactttgatcaaacttggtattgatagagttaaattaatggtaatatttatgtaaaattggcctagtggataacttacagcacgaaatctggagtaaaccatctggaagaaatgcctcgtccggatcaacgacgacagtgaacaatgaaccttgggtatacaaattagtgacagtcatcagctccaaccatccgaaaaataactcaaaaacggcgatgtacaccatgaggaatttgtagacccccatatcagttggcgatttgaacattattaatggaagtaagacaaggttacagaacatgccaaagcaagtgaatcc