Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C06H2.1   

sjj_C06H2.1 RNAi JA:C06H2.1
Simmer:C06H2.1
PCR_productsjj_C06H2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C06H2.1 Source_evidenceePCR647WS150 Sequence/Annotation Release
Chunk_score Abs_score563
Max_abs_score563C06H2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1112563611126795
Overlaps_transcript C06H2.1.1 Source_evidenceePCR647WS150 Sequence/Annotation Release
C06H2.1.2 Source_evidenceePCR645WS150 Sequence/Annotation Release
WB_DNA_textsjj_C06H2.11160aaaatggtaggagagcgataaggaagaacgagagttgtctactgaacggtacatcatgataaatcgtttaatggtcgtcaaccttgtcggcacgtcgaagaacctgaaaattaataaatatgactataatttggtaaatttctccaccttgtagtccttgaatctgttctcaatttctggagtctcgttgagtccgatgttgcatggatcaggaattctgttctggtagcgaagatcatagaaatgagctgggaaatactcgacgaaatgctgacgatcgaaatgttcaactggtggagccttggcccacttttcctccacctggaaaaagaatattaaaaatcttttcgaaataaaagtaataaccttcttggcctcctgaagtccatcagcgaccttgacctcatgaagcttaatacgggcgttgttgtaatcaacccattggtctacttccttcaaatactcggctggaacctctccgtatgggatctttacagattcatactgcttttgaagagaatcgagaactgccgaatgagccgggagggccttcttcaaagcagcaaagtcgatcttgggaagatcggccgggagctggctgacagcggattggaaagttccactgactcccttcacgcgggtgagttctgcggcgtgttccgggaccaaacgctcggctgaaattaaaagttaaaacactaaattgtggagaagttatttattacatacgtaaaataccgtaacttgtgacttaaacaacttaccgagcttcgaccagttcacggaagacgtcgctaccctcttagcggctccagacatacctataaaaattgtgatgttttaaccttatttagattaacaggaaaacgatttttgaaaataaaaagtaaatatgcttaattagcaggaaaattgaatcgttcacaaacaaagaaacatagaataactattttgagttgttttcaatttttaagtaacggaatgaactgaaaaataagctaaaacagctgaaaagcacaaaaaatagtattttctgttcaaaagggtggagtctatcgcccgtgaaaacgcaaagtgcggcgcggttttctcgggttcctcggccatttttatcggccctcgggacaaaactcggccaccaaaaccgatttcagattttt