Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C07G2.3   

sjj_C07G2.3 RNAi JA:C07G2.3
Simmer:C07G2.3
PCR_productsjj_C07G2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC07G2.3a Source_evidenceePCR746WS150 Sequence/Annotation Release
Overlaps_Gene C07G2.3 Source_evidenceePCR748WS150 Sequence/Annotation Release
Chunk_score Abs_score683
Max_abs_score683C07G2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII45005294501590
Overlaps_transcript (8)
WB_DNA_textsjj_C07G2.31062ttcacgaacaagtccagcagttcccagcttttctttcgaaagctcggagaatcgtggaacaattcgagcgtttgtagcaatagccaacaattcaatttctggacctccaacccatcttacagccggtaaatcatttgcttgcagaagatgattggcctcgtcatcgaatccccattgacagattgccaatgttgcaccactttctttcacctgtcgaatcattgtctcaaatgtttcacgctcataatcacggagagccttgaaatcttcagtggaggtgatgtcaagcttatgcttggtctttggctttggtggctcgaatgggcacgtgaggatggcgacctagaaaaatgggaagattaattattgaattgaattgaatactggcattcaaaaaatacacacagttagataccattcatgtggccattttctggattatattcaatcagcctaatagaaaaaagatgtttggcaaaaatttcaaaaatataccttggcatttttgagctctttcggcatttgtggatgagacatagtcttgtcgataacaattcccttgacaagaatagtatcttcaagtcttccaccaactttgccttccatcttgatcatttcaaagttaacatcctttgactcgatatcggccacagagagcacagcatcgacagcgatttctgcgaattggcgcaacgaacggtttacgctgaaatatttaaagtttgaatatataaatttcaataactaggcatacattttgcttccaagactagtctgagcagtctcgacgagtctctcgcgattctcgactggaaacttgtcagagatggagtcaagggtctccaaagccttcttgcaagccaaatcgaatccatcggcgatcttgattgggtggattccacggtcaatgagtttctcagcttcttcgagaagagcaccggcgagcactgaaaataaataatatatgaaattggtatgagagcacatgaggggtcagttagagattagccgtctggcagccacgtggtgaggaataaagagcggcattgcagccataaaatt