Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C07H6.5   

sjj_C07H6.5 RNAi JA:C07H6.5
Simmer:C07H6.5
PF:GL1_4D4
PCR_productsjj_C07H6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C07H6.5 Source_evidenceePCR979WS150 Sequence/Annotation Release
Chunk_score Abs_score916
Max_abs_score916C07H6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII74963777497548
Overlaps_transcript (2)
WB_DNA_textsjj_C07H6.51172tgaaggtaagtctcggcgtttcttgggaagtcaaagttgatgacaacattgacagcctggatatcgatacctgaaaaattacaattatgcatgaactacactttaaaataagaaaaatggcgctcagatatccgttcttcaattatctcttcacataacttcagagtgtgtgtatgtgttatcaatcctcatcgcgcaaattatttagtcaaacttaccacgggtgagaagatcggagcaaaccaagtttctgcagtttccttgacggaagtcatggaagacacggtttctgtgattctgagccatcttggaatgaatgtagtagcacgagtaaccgatttccgtgattttcttagcgagaagctcaacacgttgagtagagttacagaagatgatcgactggttgatttgaagttttcggaacaacgtattcaaacagtggaccttttgcttctcttgaacaaaggcatagtattgggtgacaccaagaagagtaagctcctccatgaggttgatctcatacggcttgtgcatgtgcttctgcatgaacgaagtgacggtgttagggaaagtggcagaataaagcataacttgacgctcctttgggaggaagttgatgaggcggtcgagaattccctgtaaacgagaattgttatcttattcaaatgttaatttttttacctggaagtcttgactaagaagtttgtcagcctcgtcaagaacaagtgttttacaatgttccattttggcgactcctttctccataagatcgagaattcttcctggggtggcgatgaccaagtgaaccgttccgtttagacgcatgatatcatcacggagatcagttcctccggtagtgaccataactttgagctgaatgtgtttggagagctccacgcagatctgtgaagtttggagagccaattcacgagttgggacaatgaccatggcttgaatagctttgagggctggctggatcttctcgataacagggatacaataagctccggtttttcctgttccgttcttagctcttgcgagaatatcttgaccagtgagagcgactccgatggatgcttcttgaataggactcggtttttcccatcctttctcaaaaatccccatgagaagatcgcgtccaaggcagaaatcctcaaactcgactcccttcg