Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C08B11.4   

sjj_C08B11.4RNAiJA:C08B11.4
PCR_productsjj_C08B11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC08B11.4 Source_evidenceePCR764WS150 Sequence/Annotation Release
Overlaps_Gene C08B11.4 Source_evidenceePCR764WS150 Sequence/Annotation Release
Chunk_score Abs_score659
Max_abs_score659C08B11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII80310918032194
Overlaps_transcriptC08B11.4 Source_evidenceePCR764WS150 Sequence/Annotation Release
WB_DNA_textsjj_C08B11.41104tgcaaacattgcaagtccattttcactcattgcatctgaatatgattctgcacgacattccacgtctacattacaaactgattttgttcctactgctccttctgttgctctgattgctaaaacactaataattacactttgaagaaaacaatatgaacttaccaaatgataacatttgtttcacatcgtgatttgtacatgtatttggcatacatactccaaacttgagaactgggaaaagagcaaaacagaagccatcatcagttacatttttgaccgtcttatcactaaatttgtttattttgataaacgttcaaagttactgattttttattcgaacaaagtcaaccatttacgtctgaagtgtatcattcagctcaactttgaaatctcatgccagagttgccaaatttccaaattattgttttatttcttatttcatagtttgttgctaatgattgtgcttatataggtagtttgtagtccctctaactcactagcaatgtttatctggtggtccagacatcatatttccaaaataaactagtggattgtctctctcatatgcatcaattgttgccaaacaatattgacctttccacttttgtctgtaatcgcatttaattattttttacatctaatcaaactaacccttgagcattcttgacaacgtcaatctttctacaagtgctccatgagcccacccataagttatttccactcataataccagctggaacctttcccattgcatcaaaaacattaaaaatccagtgacgttcacttttcttttgttggaaaagtggtgtacatttgcaatctgagcagtttttatgctcttcaacatgagttgcatattctactccagtccatgccaagtgcatcatgtctccaacgcaagctaaatgttttttgttaaagatatagtcattataaactaacccattgatatatcaaatgattttaatttttcaaccatttcaacagcatacttcattaattcaagatttccctcttcagctccatctctataagcttctgcgtaattgaaaaaatgacggaaaaagtcgagatcaagaattagctgagcatcggaatctgaca