Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C08B6.4   

sjj_C08B6.4RNAiJA:C08B6.4
PCR_productsjj_C08B6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C08B6.4a Source_evidenceePCR842WS150 Sequence/Annotation Release
C08B6.4b Source_evidenceePCR842WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcript (2)
WB_DNA_textsjj_C08B6.41014ctgcaggtgtatactgcggatgagaataagaaaagagacttggcggctttctttgcccacgctgttcaagaaactggagagaacaacattgctctatatgagtaagtgcattttttgctttattgtgtattgtaaactttgaaaataatcttttggtcaagttagaacctataggaaaaatcacatttccagcacactttccgatcaagatgcttcaaactgtttctaccgtggaggattttataactggtttgaaggaggaccaacaagtagctttttggatcctaaaactcctggttatactccagccgacggaaattcatgtgcatctgctggtctttattgttctgcttctgatcaaataacttatttctatccatgctcaaattcaacaatttcaaatactgctgctccatataaaggatgttattttggacgtggagccatacaaatttcgtacaactacaactacggacaattccaagattggttgagaactgtaaatattaaagttgatttattaaaagaaccaaatcttgtaatgactaaaatggatccaccacttgccgttctggcttctctttggttttatatgacacctcaaccacccaaacctgcaatgcatgatattgtaatgggaaactggaatagtggagcaaagaatgcagcagctggatatgatggaccgatctttgggccaacttcattgataatcaacaatgaatgttctggagaagatccaacaaatccaggaggtccaggagaatctagaagaatcaaggcattcaaatggttttgtggttactttgacactccaacaggaccggaggcgaccctctcttgtaaaagtaagttcagtttcatttttaaatgaataagaaattatatattatattaaaaaattatcgagttaacatttccagacatgcctgtaccactggatcaaattttctataatctgagttatcagcctgattggacatccacctggaaagatgttccatgcacttgtgc