Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09D8.1   

sjj_C09D8.1RNAiJA:C09D8.1
PCR_productsjj_C09D8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C09D8.1a Source_evidenceePCR1083WS150 Sequence/Annotation Release
C09D8.1b Source_evidenceePCR1083WS150 Sequence/Annotation Release
C09D8.1c Source_evidenceePCR1083WS150 Sequence/Annotation Release
Overlaps_Gene C09D8.1 Source_evidenceePCR1083WS150 Sequence/Annotation Release
Chunk_score Abs_score1062
Max_abs_score1062C09D8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1100929611010378
Overlaps_transcript C09D8.1b Source_evidenceePCR1083WS150 Sequence/Annotation Release
C09D8.1a Source_evidenceePCR1083WS150 Sequence/Annotation Release
C09D8.1c Source_evidenceePCR1083WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09D8.11083accaatgagcgagaagctgtcccgtatgtactctgattctgttctaactgagccattcacaatcaaatcggctcttcgcggagcttcgcagaagtcgtctccttgggttggagcgtgcatcgccttcttggtcttgttctcgattgttggaatgctgatatgttggtggttgcgttgcaataagaagtctgctggacggcatccacgacatggttctatcacaaaggttgcgttgactggaaatattatgaatggaggtggtggaatacctggagaaacaagcaagttattatcgacttccaatgaatacggacgacagattatgaacccctatgagcagatgaatggaaatcatcatatggaatcatcgatggatctttatcctttgccaacaagtcactctagatctaatggatatgcacctgttcctgtcgcaataccatctcttccaaataatggaaacaatatgactacagtatcccatccagctgttccgatagctgaacttgcgaatcatatcgagaggcttcgaatgaacaataatgcaggattccagtcagaatttgaatctattgaaactggacaacacttcacttgggaacactcgtctgctgatatgaataagcataagaatcgatacgcgaatgtggctgcctatgatcattccagagttgtactttccaatgttgaaggatatccaggaatggattacatcaacgcaaattatgtggatggatatgacaaaccaagaagctacattgccacccagggaccactcccggaaacattttcggatttctggagaatggtttgggaggagcaatcggttacaattgtgatgttaacaaatctggaggaacgaagtcgagtgaaatgtgatcaatactggccgagtcggggaactgccacatatggagatatcgaggtgacactgttggaaagcgttcatttggctcattatacgatgagaacgatgcgattgaaaatggttggagaacctgaagttcgagagatcaagcatctacagtatactgcatggccggatcatggagttcccgatcatccgacaccgtttttgatctt