Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C09D8.2   

sjj_C09D8.2RNAiJA:C09D8.2
PCR_productsjj_C09D8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09D8.1a Source_evidenceePCR682WS150 Sequence/Annotation Release
Overlaps_Gene C09D8.1 Source_evidenceePCR682WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598C09D8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1098503510986181
Overlaps_transcriptC09D8.1a Source_evidenceePCR682WS150 Sequence/Annotation Release
WB_DNA_textsjj_C09D8.21147tccccattatccacattggttacggtagcaacccgtcaaggaagtaagtttttgtagcacatcttccgattaaccctgatattttcctgcagtccctggccaacctccaatgttgacggttaaagcgctcgactcgaggcgaatgcaattgacatgggacaaacctctttactcgtctccagttgttggatacactgtccgatataacacttcggatggagaaaaggagctgacattgacatctcctcatgaaaagcatgtggtgactggattgcatccggataagtattattactttaggtgcgcttaattgacatcatgcttggagaattagaaaaaaattatgagtttctgaatttttcagagttgctgcttactcggatagaggacagggagagttcactgaaccaatgatttccaaaacgattgcatcgagtaagtataaattgatatactggcatgaattggaagattagactagcatcttccaatttctcaatattgtcattttttcgtcccccttaggttttgtgaatagtcgtcccgtgtatttcagtacctctatcctctccaacaattgtgtctgcggcggcaacgtcctcgaaaagtgtggaaatccgatggaagggtcccgaacagaaaaagttgaacggcgtcttgacggcttatcggattaactactttcgtctcgaggactctaaaactgcaaatttggaatcggttgagtacgacgaggatatggacgattcctcttcatttcttgatcgaatgtctgttgtggtgcctagtgatgcgacctcttatgttctatccgatcttctaccgtactcatcctacgagattactgtcgcagcgtcgacaatggatggatacggcccggaaagctcgattcgtgttgtgaaaactcttgaggatggttagtaaatatttaaatttcgttaatttttcagggggctccgaagaagaatcaactgctccgggtgagtaaaaagatctgtaacaagataaaaagggtttgaagggaggggagagggggaaaacaaaacaaaacaaaaaaaccattacgaaataaataaaataaaactgagttcgtctacttaatgcgttttgtgctcactagtcggtggcagtggcctgtttctcatca