Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C10G11.4   

sjj_C10G11.4RNAiJA:C10G11.4
PCR_productsjj_C10G11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC10G11.4 Source_evidenceePCR874WS150 Sequence/Annotation Release
Overlaps_Gene C10G11.4 Source_evidenceePCR874WS150 Sequence/Annotation Release
Chunk_score Abs_score833
Max_abs_score833C10G11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI62976856299061
Overlaps_transcriptC10G11.4 Source_evidenceePCR874WS150 Sequence/Annotation Release
WB_DNA_textsjj_C10G11.41377gagattcaaccatctggaatcagttgcactagttaatcagatgtcattcacttccttcttctcttttcaaacgaaagaaaatcaatgtccttcccaacatcacttcaagattattatgctacaaactacacgagatgctcagaattgttttcgattttttcaacatctgaatttttatcgttcggggcgaaatcccaattctttgtgcttgttccaattaatttgtttggcttttattgtattttgttcaaaacgccgaaatatatgagtgaatttcagtttcatttgtgtcatttgcagttttggtacgtttggtaaatgttcacagaatttcaaaattaacaacaaaacaaaccaaacgaagccgtgcaaaagtgtgcgcattgaaaagtacagtaacccaacttaattcgtaattatattcgttttcccattttaaaaatctcaacggcattattttattgtaaaactaaactgtaaaacataaaacatgatagaaaattcttggtcggcagcaaaaaaaaacttgcaaattaacatggactgggttactgtactactcaaaggcgcgtaccctttacgcaacttttatttaaaagtattaagtttgtatcacaggaaattgcaagtatttatcagaaattcaactctccatgtatcttttttcgaactttccaggttcacagttctcacaattttctacacaatcctcacaactccatatcattttttcccggcttcagtgcgttgttcagttggattatttcgtgatatgaatataagttcaacatatcaattgcttctaatcaatatagtaactggaggaattgtatccgcagtcatattactttttgagaatagacacaaacatcttgtaccacctactgatattttttataagatcaatggagttcatcgattaatactcggaatttttaattttcttcttggaagtttaggggcatggacgatttttctacaagacggtaatcaagagcttgtaaaaatggaatatctcaaattagtaccttgtccgacaaaactttatttcgatgaatgctctgtagccattcccagtgccaaaaatatttgggctctgggagttggacctgctggatgcctaattcctattcaagttatattctttataagtcatagcttgatgtatcttcgaaaaattcaaaacatcaacactttttcgaaaagaaccaagaaacttcaaaaatcattttttcgtgctggaattgcgcaagtgacttctccaattttggttatcgttgttccattgtttcttttaacttatattttaattacaaaacagtatctgccaggtaatttacttttatttgtttcatgaaagatgccaaattgagattt