Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C14A4.13_f   

sjj_C14A4.13_fSequenceATTCACCGAGACGTCAAACC
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_C14A4.13