Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C14A4.2   

sjj_C14A4.2 RNAi JA:C14A4.2
Simmer:C14A4.2
PCR_productsjj_C14A4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14A4.14 Source_evidenceePCR961WS150 Sequence/Annotation Release
Overlaps_Gene C14A4.14 Source_evidenceePCR961WS150 Sequence/Annotation Release
Chunk_score Abs_score901
Max_abs_score901C14A4.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1058260810583758
Overlaps_transcriptC14A4.14 Source_evidenceePCR961WS150 Sequence/Annotation Release
WB_DNA_textsjj_C14A4.21151gcaatggatcaaagcaaggtatttgaattttaaattttgtaaaatatatatttaatatgattcattttcagtaactctaaaacaccagacgacatcaatgttgagaaactcttcgttgagaaggaagtgcaaaagctactgacggatttaacagaaattgatttggagcacaaagtgttcagaccgcgaagaacttcgattcaacaaagatctcatttcgctcttatgactgaagaacgacttgaaaaggtttgtttgaaaatgatttataatttaccgcatttgtcgatttacagtcgagtttctgataaacttggatctgctagactagaaactactcaccaaaatgagaagctatttattcaatttgacttatttttttccagactcgagagcgtatgcgtgaagaagctcgcagattcctacaatttgttccagtgaaagaacctcgcgaggagagtgttcagatcctcgccaaagatctcgaattgaaggattttgacactagcaaattcgtattcactgatatcactttcgatgcgaccgaccaggatcgtactgtagtcgtgagagaacccgatggtacattgagaactgcgaatccagaagaacatgatcgaatgaacagaacttattatcaaaaaccgaatcgttctgtgaatcctccaccactcttctcggatccaaatctacaaaatgctcttgataagaatgatcacgaattcgttctagactgggcttgctggttttacgagcctgacgatccggcctatgttcgtttgagtcaactcgtatttgatcgtatcaatgaatctggtaaattccatgtcgtaacctcaactcgtcactttggaccattcactttttatttggcactgaacgataacattcagaagcttttgaactattttggtggacttggaagattatccgactgtgcaaatcttgtgagacttcagaaggctgttcgtcccgattggagagttacaattgctcagggagattctgatgagaagattgtaaaggattttgcgaagcagaatgctcgattccgagatgaaattcaggatcttttgaattttatcaacaatggaaaattgaaatcagatcaggagcagacggagcacgtgagggaacgatttggagtacga