Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C14A6.7   

sjj_C14A6.7RNAiJA:C14A6.7
PCR_productsjj_C14A6.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14A6.7 Source_evidenceePCR315WS150 Sequence/Annotation Release
Overlaps_Gene C14A6.7 Source_evidenceePCR315WS150 Sequence/Annotation Release
Chunk_score Abs_score210
Max_abs_score210C14A6.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1817002618171225
W04E12.5 Chunk_scoreAbs_score59
Overlaps_transcriptC14A6.7 Source_evidenceePCR315WS150 Sequence/Annotation Release
WB_DNA_textsjj_C14A6.71200gctggggctaatgtaaaagaactgttgatgtaccattgctttactataggagtattgtaggaggtacacttgtggtacggtagggtctgtaggagtactgtagagtcacttcaagggtactgtaggggtactacaggagtactgtggaggtgtgcacgtacgtttattaaccaagaacaaaacttcaatcaagtttataggcgaaatagaataaaataacgaaaagtgccggagacagagcaaggattattagttgaaaatttgagaattctttcgcatttcgggaagctttccacgattgagcaatttcctgaaaattccttttgagtactgtagtcttagtgtaggattattgtatggatatggacggggtactgtaggagtactgtaggagtactgtagagatacttgagaggtactgtatggatacggaaggggtgctctgcggggagagggtactgcaggggaactgtaggcacactgtagggatactgtaggagtactgtatggttactgaacggatactgtagggggagaggttacgctgaaggggtactgtatggatacagtaggggtacagtaggggtttgtgtaggagtactgtaaaaatgccgaacgactactgtagacatacctcgtgaataatctccgcctcagcctcgtatttttccgcgtttttcaaaagctcccgagcttttttgtgatttccacttgcttcggcggtgtaggcgtcctgaaattcgaactgtagtgcactcttctgaccccctttcactcactcttctcgcctgctgagccaacccgtcaagccagaattcgcggagggtcggatccaaatccttctgaaatttgccatttttgggtggggctaaacacgaaaaagcacctacctcatcgtaaaaaattttttcaggcatttaatagctgaaaatttagaattttttagaggaaaaccttctgaaaagtctcacctttagaaatcaggaaaataaattggaaatagtttcaaatcatcatttttgttggcaatttggctaaacgggttcacgtgaaatttcattgtacaagattttttctaaatcttcatgaagtatgcctgcctgtaggtagacaggcctctaggctacaaactataaactacaaacaaactacaaagaaaatttattcgttaaaaaaatcgttaaattgaaatcccaaaaa