Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C15C6.2   

sjj_C15C6.2RNAiJA:C15C6.2
PCR_productsjj_C15C6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C15C6.2a Source_evidenceePCR579WS150 Sequence/Annotation Release
C15C6.2b Source_evidenceePCR788WS150 Sequence/Annotation Release
Overlaps_Gene C15C6.2 Source_evidenceePCR788WS150 Sequence/Annotation Release
Chunk_score Abs_score725
Max_abs_score725C15C6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1220418712205748
Overlaps_transcript C15C6.2b Source_evidenceePCR788WS150 Sequence/Annotation Release
C15C6.2a Source_evidenceePCR743WS150 Sequence/Annotation Release
WB_DNA_textsjj_C15C6.21562acctcaaggctaccaaatctttcgtgttccgtattagggcaaagtgccggcgagcggagacctaggcgagcatgtggtgccattacggctgtcccattacgggctgatctacaaaaaatgcaggatttttttgcccaaaaaatgtggcgtcaacactttcttaaccatgcgaaatcaattgaaaactctgccgcattttttgtagatctatgtataaaccgaaatgagacactctgaaaccatgtgggcgaagtccgaaaaaatttttttggcgaattcagcgaccgacaaaaccaccaaggtactagaccataaccttcctatttttcagtacatcactcttccaaatcgccacagcttcacagtggattccaaggatgtgttccaacgtggtcaggtgctcagctacatccgatccaaagcacccttcctgctcgaacatatctccgaggcaaaggagcgattgataaccgtgacgtcacgcggtttgatgatcatttacgagaatgacgaccacggattggtgattgatttgcgatcggccaggaatgttctgtgcactgctgatcgttcgaaaaagcagcgtcatgtaaattgagccgtctgactctttcctattcaaattccaataattgttgcagttccgctgtcacatcaaaatccgcatgcaacgtggcaatgttcacctctttgtcggccataatgatgttcacaagtggacgtgcgcgattatgagagccgccggaaagtgcttgccgtctacagagccccgcgatgatggaagccttaatgtcgcgatgatgacggcggtggaggattctggaatctttgaagagatgtcgtctacatcgtcagcatcttatgactatgatgaggatgatgaagtcgacgaggtgaagcccactgccatcgagcaaatgtaagtgggaagtcgatgaggttttgaagctcacatatgcgtgaaaatggaagaatggccgtgtaaaacctctaacacatgttgttatcacaatcttgtgtcgatttacgcagcctgtgtactcctcgaggagaagacttaataattaaaattctggaatttgggccatttttgtgaattattctgacattttcccggtcaactcaagcattttaggtgaaatctgatggaaactgcatgaaaaattagctaaaatgctctgaaatcgggaattttagccgcgccaggcctgcgtaaatcggcacatggccgtggaagaggtttcacacggccagctcttccgtttttaaatttcaaaatttatatcattttctcaacatcatcctttcagaccacttccccatgtctccgtccggtctcttcgccagaaactcgagaaggagctcgtcctgaagcctaaggagcaagtgctcgccgagcaacaacacaaagccaactgcgatgagccaagctttgtctctgaaatcttctgcaccccaagagcagttttcagcgatgaaactgtagttctgctggagccaacgaatgccagagagaggagagaatacgaggcgcaggcggacagagaaaatcagtggtggac