Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C16A3.6   

sjj_C16A3.6 RNAi JA:C16A3.6
Simmer:C16A3.6
PCR_productsjj_C16A3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC16A3.6 Source_evidenceePCR758WS150 Sequence/Annotation Release
Overlaps_Gene C16A3.6 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII63796136380540
Overlaps_transcriptC16A3.6 Source_evidenceePCR827WS150 Sequence/Annotation Release
WB_DNA_textsjj_C16A3.6928atccacgtcgtttatgggaaaagacaaagttgtcaaaggatatgaacaaagcattggaacaaatcagtgatcaacttcttcattggagtgaatatgttagacacaagtgcaaagctcgtctcatccgaattcatcaatatttgatcagaatgcgtaaaatggcagtccgtggaaagtaagtttaaacttatagaaactgaattttgcatagtattatttattttcagccagaagaaactcattccaattggacggaaagtggaaagacgtgagaaacgtcgtgaagagaaggcacttgttgcagctaaacttgatcacgctattgagaaagagctcttagccagacttaagtgagttgatatattagaaagtgcacattttgaatgaaacaacttttagacaaggaacatatggcgatgtttacaacttccgtcaagaggcattcgaacaaatgctggaaaacactgaaaaagagttggaagtggagcaagaactcgagcaggacgacgcagacacgggtgagactcagttcgtcgctgactttgatagttccgacgatgaggatcaggacatggaagacggaggtgatggacattggtcaccaggagatactgacagtgagaacgaggataattggcagccagaacaagaacaagaggattcggatgaagatgatgaggaaggaggtgatgagccaatggaaattgaggagccaccaaagaagaaggtaaagaaggagccgaagaaaaagactgggaagaaagctgctgatggaaagaagaagaagctcaagaaacgagctcatgttgagattgaatacgaagaagaaacggagccacgacaaagggtcaaggcataaaacttcgcattccattttgtctgttatcgttatttttgttcttttcttttattcgccctcttccaattg