Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C16C2.1   

sjj_C16C2.1RNAiJA:C16C2.1
PCR_productsjj_C16C2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C16C2.1 Source_evidenceePCR447WS150 Sequence/Annotation Release
C16C2.3 Source_evidenceePCR107WS150 Sequence/Annotation Release
Overlaps_Gene C16C2.1 Source_evidenceePCR447WS150 Sequence/Annotation Release
Chunk_score Abs_score363
Max_abs_score363C16C2.1
Specificity_index0.854
Rel_score1
Map_statusBest_ePCRI97271499729074
C16C2.3 Source_evidenceePCR107WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRI97271499729074
AC8.5 Chunk_score Abs_score62
Specificity_index0.146
Rel_score0.171
Overlaps_transcript C16C2.3 Source_evidenceePCR107WS150 Sequence/Annotation Release
C16C2.1 Source_evidenceePCR447WS150 Sequence/Annotation Release
WB_DNA_textsjj_C16C2.11926atgttgctcttctcagctcattccatttattcacactttattttcttgattcaactatgccttctgccgatacagagttcatacgagttattcgcatcaagagtgctaatggttcagagaagatgcttgaaattccagcaaaacttgatttggagagaccgaagagaccgcgtactgtattcaccgatgagcaattagaggtaaggcagaaaatgaaactgttgagattgtttaaaaacgattatcgttcgagaagaagttaaaacaaagctcgaattcagtcacagcaatcgctacaggttcttcattttacatatttgtacatctaatgtagatcatgaagtttgtgacatttcaaattttaaaatgaagagattgctacaaaattcatcataggtgtttttgagaatcacatttttcagaagctagaagaatcattcaacacttcaggctatctcagtgggtcgactcgagcaaaactagcggaatcccttggtcttagtgacaatcaggtcaaagtttggtttcaaaatcgaagaaccaagcagaagaaaatcgattctaggtgagtcattactctaatttaacggaatattctaggaatttcagagatcctataaagccggaaacattgaaacctgctgaaaactatcaaaacgtctatcagaactatcaaaactattggacagccgctgcatttctatcaaacaatgtcatttcgtcataatcatttcgaatttcaaagctacgataaaaggacaaaggaaactcaccttttactgataatctttccttttttgtcgcctcgattcgggctcgtttgcttttcttcttgatgtctgaaaataataaattataaaagtgtttaacatggaacgaacgttgggagaattaatcacgatagcttgagaaaagaagacaaatatcaaattcactgttaattttcattaattatccgagaaaacatttttcgctgcggaaacataataaaaagcctaggagttgaacgtttctaaataatgctacgtggcgccttttttctgccttcttcctatgttaaatatggaatgtgcaagggtcgtcactttttgcgcacaaagtgtcacaaaaaatttaaaaagttgggtgtgcactttcgtgtctaactttgctgtacctgcacatttttcaattttcttttttgtaggaaatagagaatcgctttttctatcttactatctaaatggttatttgatttgattttatcttttaagagaaattcttgatgaaacacgaaaaaatcacttttttcgcgtgtcgtgtcgctttttttgcacacgtttagaggtcatagtataaaatgtttttgataaggtaactgtatatctgggattgttaaaaatttttagtttttgcaatttcatctattttgaactgagttatgatgatttgaaaatcggactcgaaaaatcccggaatttcgaaaattgcgttgaaaacatgtttaacgttcgtatttttgttttattttacattatcaaatgtaaattttaacgtagattccgtttttctaaatagttttctcattatccaaccggaaagttacgaaaaaagcataaattcacgatttttcaatgaaattgtgcgaattccccctggtgtttttggtgtgcaaattagtgatttttgagattctttcgcctataagtcggtcagtttggcactttttggggtaaatttttcgaaaaacgtatttttcaggaaatttactcttcaaaaatataattttttttacaaaaaagtcaaaaataacttcagaaatcgcaaatttcataattttctcaaaaaaaatgacgtttttgctggaaaaataaaaaattttccactaccgaatgggattttatgtcaaattcgtaattagtacataaataccgaatgcaagctgaa