Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C16C2.3   

sjj_C16C2.3RNAiJA:C16C2.3
PCR_productsjj_C16C2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC16C2.3 Source_evidenceePCR768WS150 Sequence/Annotation Release
Overlaps_Gene C16C2.3 Source_evidenceePCR853WS150 Sequence/Annotation Release
Chunk_score Abs_score749
Max_abs_score749C16C2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI97155369717101
Overlaps_transcriptC16C2.3 Source_evidenceePCR853WS150 Sequence/Annotation Release
WB_DNA_textsjj_C16C2.31566actgaaaaatgcgatatgacacccgtttgtttagaaaagttttaaaaaatgatttgtaaagtctgataaaccccgtaagaaaattttatcctaaggcaacatcaggagcatagtcacatatagtttgtagtatagttgagaacattccatgcattttctcatcttgaatatcgtgccggaataatacagttgcccaaagtgataattgatctgaaaattactaaattatattattcttcaaattcaacaacacctttcaattcgtatttctgactaaagaactctcggagcatcagacatatcaattcgagaactgcttgattctgtttgggaagacttgatcgaacaacggtccataatctgaaaatgtattgattagaacaattttttttttcaaataaaatattactgtctggcatcggttcgatattttatcatttctttatgaatgattttgaacattccttccaaaattataggctcatccagagagtcgagcaatcgtattaatgcgctgtacaacatataagaagatgcaagttggcctgaaataaagaaaatattaaacaaaatcgttgatatccagaacatgaacatttctaggtaaacatttttagaattttcggtgctttttttcaaaaaatctatttttttataacaaaagtgggcggaaaaatgaagaaacaattctgtcgataactcataattttttaatttaattttgcactttttcatgcaaaaaatggcactcggaattgtaggaatatgctcaaaatctttaactgtttcgattttttccaaacttgaaaaaaacttttcttttccgttctcgaaaataataaattccggaaacagtcccgattcttgaaatattttttaaaactcactcaaatcgtcgggctgtccagattcaagtgcagatctgattctattaaagacctcattgtcctgttcttcttcaatatttaactgaactgctccacgtgttcgaagagccatcacaagccgataaattactcgaggaacatttggaggacagttgtcagaaagtgaattttccgagaaatctccaaaatcgatgagattaacttctttttttggtctcattgataaaagtttctccaatgtacttccaaagcatgaattgttataaactgctgtgattggaataaaataatcacgtccattttctaaatgtaagacaagaatttcttggagctgcccatttcgaatcaaatcttgaattcgtcgaacaatatccgtgcttattgataccgttaagctgatctgaaataatccacttttctccagaaaattattaccacgaaacagatcattagagcgaaaactattttaattgaagtttgaataaagaaactttatacaatagtgtccgatggtttttgtccagaaaatacatgaaacagtctcaatatgccaaatataactgtaaattattttttcaattttttgaattctcgggcaaatttgtgaataagtttcgatatttttgcgtttttcttcatttttaattactttttattacatcgaatttttcaggcattt