Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C16C4.2   

sjj_C16C4.2 RNAi (5)
PCR_productsjj_C16C4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC16C4.2 Source_evidenceePCR791WS150 Sequence/Annotation Release
Overlaps_Gene C16C4.2 Source_evidenceePCR791WS150 Sequence/Annotation Release
Chunk_score Abs_score707
Max_abs_score707C16C4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII18911541892648
Overlaps_transcriptC16C4.2 Source_evidenceePCR791WS150 Sequence/Annotation Release
WB_DNA_textsjj_C16C4.21495actctccttgcgctgaagacaaaaaccaaaaattatttctattgaatcagactgttaaaaatgtttcgagcattaaagaaggagctgactattgcacaaaaacagagaaacgattcaatattccatggttagttatctaaggaaactatctattattcattatttttttaaggagactactgattcaaagaagaaatggattttttggattattaatatgctgtcaaaaggaacaatccaatagaagaaactggactattgaagtggattatacgctaaaactactttccgtaaatggtcagagcttaacttccaatgattcatacactttcaacgggccaaaaggtcgcggccgggataaacttataagatgggatgatatgctagagaagtatatggtgaacgacagtattataattgaagcacgtgttaagataattaaaatgactggatgtgaagaggaaaaaagtatcgatgatttggaagatgacttctctgattgtgtgatcaatgtcggaggacagaactacactgtgaaaagacaataaatcccttttctcggatttttcagtttatgcaaatgtttatgaaattttttactccctagttgaattttcaattatgaatttttatctgttccattgatttttttaatgaatttgcaaagtgaaataattttgcagtttctgataaagcaattataagagaaaataattaaaaagagaaacctctgaggaagctatgtatatgtttgcactatttaaccatagcaagccacttgttgactttcactgaaatttagatactcaagaacacgttatgtcaggttgtcccataacggtttgatctacaaaaatgcgggaattttttccccaaaaatgtgacgtcagcacgttcttaaccatgcaaaatcatctatgtaaattcccgcattttttgtagatcacaacgaatatttcaaagttaaccaactttatttcaaatcaaatatcaataatgcacaatcaaatctgttttcaatagtcaaatgccatttccatccacttttccagggaatattcttcaattccaaacgttttgatggtcttcacatgagctttgtcgttgactatgtacttttcttctataagatcgaaaatccaattggctatggttttggcgtcaaaatatggatcgaatcatgtttgagagttaattgtactgcaaattatttaaaatacaatttttttgacggaaatttcgaaattttcaagacttttttctacgacaaatattggaatttctggaaaaatttcaaatttatcagcaaactcacctcttcttcaaatatcctagtaaaatccaataaaatttagaaaaaatcaataacgaagggggcacctaacacatggcgcctaataatacatactggcagtagtacagaactgtgtttactctgttggctctgttcttaatagctcaagacagggctcaagacgccagagaaaaagacgaa