Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17E4.5   

sjj_C17E4.5 RNAi JA:C17E4.5
Simmer:C17E4.5:Screen_A
Simmer:C17E4.5:Screen_B
PF:GL1_5C5
PCR_productsjj_C17E4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17E4.5 Source_evidenceePCR618WS150 Sequence/Annotation Release
Overlaps_Gene C17E4.5 Source_evidenceePCR905WS150 Sequence/Annotation Release
Chunk_score Abs_score842
Max_abs_score842C17E4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI94209779422152
Overlaps_transcriptC17E4.5 Source_evidenceePCR905WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17E4.51176agagacagtgaataatgcgtggttgtataaattaataaatggaacaaaaaatactttgtgatgaaaattaggtgaaaataaaatgggaggaaaaaaagaaatcgaaaataaatataagagaaaaatcaagggaaactcatagaagatctcaagaaaggaaaaagataagtttctgaataatgggcgggcaggagtgcgccgaacgtacagataaaggtataatttttcgagtttgatttaatctgtcttctcgtgagttcttagtacggggcgaatccggggcgtcttctagccccacgacctcttggacgaaatccacctgcatagacgtatttgacaatgacgttcccgcgtccacgtcctccacgcccacggaatggaggcctgttagttgttgacatgcccggcttgtttgttcgttttggatctactttgatttgtcggcctctaagaagactgtctgtcatagctagtgcgttttgcattccttccttctcggtaaattcgacatatgcgaatctgaaagaaaacgactattagtaagaatttgtgattttcaaatagattaccctttcggatgtccactgaatctgtcacattgaatagtgacgcgggatacagatccgcatccatgaaaatgttgctctatttcttcggcagttgcaccataatctacatttcctacgtacactgatttagcatcagcttctgctttctcctctggtgttaagagcgattgtgatgaattactctgactgcttgtgttcaagttcatgtgcccgaccatttcattttgaatagctttcaactttttctgttcctcctcgatctcattcaagtctccttcgatagcagagagatcctgaagaaaatcaataattgaaaatttagatgcaaaaaaatattgttcttaccgcatcatctccagtcatatcctcaatgttgagaacatcatcgtcgataatatcgttatcgctcataatgtgaacgagtgcgagtgcgttacactgaaataatcaattatacaaactgggtaatatgacaacaattatttggaagtatgaaaatgaattgaaggaaaacgctcaatttgaaactttgagaatctattcgaatattttcgtaagttgagttcaagaataacaaaaaaaataaccacactttttcgaaattcaa