Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C17F3.1   

sjj_C17F3.1RNAiJA:C17F3.1
PCR_productsjj_C17F3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC17F3.1 Source_evidenceePCR267WS150 Sequence/Annotation Release
Overlaps_Gene C17F3.1 Source_evidenceePCR305WS150 Sequence/Annotation Release
Chunk_score Abs_score263
Max_abs_score263C17F3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI66691556669606
Overlaps_transcriptC17F3.1 Source_evidenceePCR305WS150 Sequence/Annotation Release
WB_DNA_textsjj_C17F3.1452agcgtgtaaccttttgaaaacaatttaattatgtttatttccgtgatcttcccattaacctttgctttttttttatttttcgtgtttataaaagtcggaaaatcgtcagaaaattcagttcccgttaaacccgaaaagcttcgtcaagcaaagatgataattgcttctttcgtgagttttttttctgctgtaattttcaatcaatggacacaagaatccgttcaggttctcgccatcaccgccttgcccgcgattgccattttctgcggaggaaagaaaggagccggtgaatctaaagaaaagccaaaggaggatgtgtatgaggatttggcaccaggagataagaagtaatacttgtgaactgacagaatgcacaatcgagcaacttcctgtcatttctatcgtacatgtgaattggtattaatgaaatatttgattgagccctgttgttt