Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C18D4.2   

sjj_C18D4.2RNAiJA:C18D4.2
PCR_productsjj_C18D4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C18D4.2 Source_evidenceePCR826WS150 Sequence/Annotation Release
Chunk_score Abs_score784
Max_abs_score784C18D4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1752876317529839
Overlaps_transcript C18D4.2.2 Source_evidenceePCR826WS150 Sequence/Annotation Release
C18D4.2.1 Source_evidenceePCR826WS150 Sequence/Annotation Release
WB_DNA_textsjj_C18D4.21077ctgccttctccaaatcttcgaaacaaaacgttgttgagtggtatcagaagagattgtgcagtttcacgtatattttacgtcacagtctactcaaccaaaagaaaccaatcgaatcattttccataagtcttccctggttcattaatgagaggggtagtccagaattctattcggctggttatcattttatttcaatgtttggccatgaagtaccaatgtacaccaagtttcttgacctcaagattgaaagtcgtgcttgtgagcaatgccgaaaaacggatgaagttcgcaatttggcaagttgtgatgttcaccaaaagatgtttcaaaagcttttggaagaaaatcgagaaatatgcggacctaactccggacatccggattaccagaacagaccgattacttacacacaagacgagtacgaacagagaattgatctttttgtcaaatactttgaagacatcttgagctcagttggtcatacaattcctgtcgaagcgttgtacatgcaagcctgtaatcaaaatacagtgttgcgtgttctgcggcatttggattcacgtttgttgaaaacgatatccataaaaattgtcgaagatgatcaagacaaaccatgtaactgggttttgccattggaaattaatgagatttgcgaattggatcaatggaagttcgcggaaaacattgaagtagaacacttaattgacacggatgacgtgaggcattttggacacttttccgaagctaatttgaaattaaccagactcacaatggaaggaattttgagtttaaaaattgtgagtttcaaaattttaacaaggaaaggaattcagtctctagtgggcttaaaacgttggcaaggtcttagatctccgaacgagtacaaacgttccgcgaaaaaccatttttatttcgtttctgacgagtttatttttctcaaaactttataagatcatattgcaacataagctttcaaatatgagaaaccatattttgatgccaactgaattcctttccatatgggtatcatttaatgtttatattccagacatttcttcgctcgcacaacttcataaa